Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from Nucleotide

Items: 1 to 20 of 1471

1.

rs781762653 [Homo sapiens]
    Variant type:
    SNV
    Alleles:
    G>T [Show Flanks]
    Chromosome:
    8:27599900 (GRCh38)
    8:27457417 (GRCh37)
    Canonical SPDI:
    NC_000008.11:27599899:G:T
    Gene:
    CLU (Varview)
    Functional Consequence:
    coding_sequence_variant,non_coding_transcript_variant,stop_gained
    Validated:
    by frequency,by cluster
    MAF:
    T=0.000004/1 (GnomAD_exomes)
    T=0.000008/1 (ExAC)
    HGVS:
    2.

    rs781592788 [Homo sapiens]
      Variant type:
      SNV
      Alleles:
      C>G [Show Flanks]
      Chromosome:
      8:27606346 (GRCh38)
      8:27463863 (GRCh37)
      Canonical SPDI:
      NC_000008.11:27606345:C:G
      Gene:
      CLU (Varview)
      Functional Consequence:
      intron_variant
      Clinical significance:
      benign
      Validated:
      by frequency,by alfa,by cluster
      MAF:
      G=0.000071/1 (ALFA)
      G=0.000036/5 (GnomAD)
      G=0.000189/50 (TOPMED)
      G=0.000462/56 (ExAC)
      G=0.000546/137 (GnomAD_exomes)
      HGVS:
      3.

      rs781555512 [Homo sapiens]
        Variant type:
        SNV
        Alleles:
        G>A [Show Flanks]
        Chromosome:
        8:27609132 (GRCh38)
        8:27466649 (GRCh37)
        Canonical SPDI:
        NC_000008.11:27609131:G:A
        Gene:
        CLU (Varview)
        Functional Consequence:
        intron_variant
        Validated:
        by frequency,by alfa,by cluster
        MAF:
        A=0.000071/1 (ALFA)
        A=0.000004/1 (GnomAD_exomes)
        A=0.000004/1 (TOPMED)
        A=0.000008/1 (ExAC)
        HGVS:
        4.

        rs781484054 [Homo sapiens]
          Variant type:
          SNV
          Alleles:
          A>G [Show Flanks]
          Chromosome:
          8:27608067 (GRCh38)
          8:27465584 (GRCh37)
          Canonical SPDI:
          NC_000008.11:27608066:A:G
          Gene:
          CLU (Varview)
          Functional Consequence:
          intron_variant
          Validated:
          by frequency,by alfa,by cluster
          MAF:
          G=0./0 (ALFA)
          G=0.000014/2 (GnomAD)
          HGVS:
          5.

          rs781442821 [Homo sapiens]
            Variant type:
            SNV
            Alleles:
            G>T [Show Flanks]
            Chromosome:
            8:27598112 (GRCh38)
            8:27455629 (GRCh37)
            Canonical SPDI:
            NC_000008.11:27598111:G:T
            Gene:
            CLU (Varview)
            Functional Consequence:
            non_coding_transcript_variant,3_prime_UTR_variant
            Validated:
            by frequency,by cluster
            MAF:
            T=0./0 (ExAC)
            HGVS:
            6.

            rs781400051 [Homo sapiens]
              Variant type:
              SNV
              Alleles:
              G>A [Show Flanks]
              Chromosome:
              8:27597672 (GRCh38)
              8:27455189 (GRCh37)
              Canonical SPDI:
              NC_000008.11:27597671:G:A
              Gene:
              CLU (Varview), EPHX2 (Varview)
              Functional Consequence:
              downstream_transcript_variant,non_coding_transcript_variant,500B_downstream_variant,3_prime_UTR_variant
              Validated:
              by frequency,by cluster
              MAF:
              A=0./0 (ALSPAC)
              A=0.0003/1 (TWINSUK)
              HGVS:
              7.

              rs781358743 [Homo sapiens]
                Variant type:
                SNV
                Alleles:
                C>T [Show Flanks]
                Chromosome:
                8:27605330 (GRCh38)
                8:27462847 (GRCh37)
                Canonical SPDI:
                NC_000008.11:27605329:C:T
                Gene:
                CLU (Varview)
                Functional Consequence:
                coding_sequence_variant,non_coding_transcript_variant,synonymous_variant
                Validated:
                by frequency,by cluster
                MAF:
                T=0.000004/1 (GnomAD_exomes)
                T=0.000008/1 (ExAC)
                HGVS:
                8.

                rs781315039 [Homo sapiens]
                  Variant type:
                  SNV
                  Alleles:
                  T>C [Show Flanks]
                  Chromosome:
                  8:27610731 (GRCh38)
                  8:27468248 (GRCh37)
                  Canonical SPDI:
                  NC_000008.11:27610730:T:C
                  Gene:
                  CLU (Varview), MIR6843 (Varview)
                  Functional Consequence:
                  non_coding_transcript_variant,intron_variant
                  Validated:
                  by frequency,by cluster
                  MAF:
                  C=0./0 (ExAC)
                  C=0.000008/1 (GnomAD_exomes)
                  HGVS:
                  9.

                  rs781290752 [Homo sapiens]
                    Variant type:
                    SNV
                    Alleles:
                    A>G [Show Flanks]
                    Chromosome:
                    8:27616379 (GRCh38)
                    8:27473896 (GRCh37)
                    Canonical SPDI:
                    NC_000008.11:27616378:A:G
                    Gene:
                    CLU (Varview)
                    Functional Consequence:
                    upstream_transcript_variant,2KB_upstream_variant
                    Validated:
                    by frequency,by alfa,by cluster
                    MAF:
                    G=0./0 (ALFA)
                    G=0./0 (TWINSUK)
                    G=0.000007/1 (GnomAD)
                    G=0.000008/2 (TOPMED)
                    G=0.000259/1 (ALSPAC)
                    HGVS:
                    10.

                    rs781235302 [Homo sapiens]
                      Variant type:
                      SNV
                      Alleles:
                      C>T [Show Flanks]
                      Chromosome:
                      8:27614748 (GRCh38)
                      8:27472265 (GRCh37)
                      Canonical SPDI:
                      NC_000008.11:27614747:C:T
                      Gene:
                      CLU (Varview)
                      Functional Consequence:
                      upstream_transcript_variant,2KB_upstream_variant
                      Validated:
                      by frequency,by alfa,by cluster
                      MAF:
                      T=0./0 (ALFA)
                      T=0.000004/1 (GnomAD_exomes)
                      T=0.000004/1 (TOPMED)
                      T=0.000007/1 (GnomAD)
                      T=0.000008/1 (ExAC)
                      HGVS:
                      11.

                      rs781234293 [Homo sapiens]
                        Variant type:
                        SNV
                        Alleles:
                        A>G [Show Flanks]
                        Chromosome:
                        8:27615576 (GRCh38)
                        8:27473093 (GRCh37)
                        Canonical SPDI:
                        NC_000008.11:27615575:A:G
                        Gene:
                        CLU (Varview)
                        Functional Consequence:
                        upstream_transcript_variant,2KB_upstream_variant
                        Validated:
                        by frequency,by alfa,by cluster
                        MAF:
                        G=0./0 (ALFA)
                        G=0./0 (TWINSUK)
                        G=0.000015/4 (TOPMED)
                        G=0.000029/4 (GnomAD)
                        G=0.000259/1 (ALSPAC)
                        HGVS:
                        12.

                        rs781202560 [Homo sapiens]
                          Variant type:
                          SNV
                          Alleles:
                          T>A [Show Flanks]
                          Chromosome:
                          8:27604054 (GRCh38)
                          8:27461571 (GRCh37)
                          Canonical SPDI:
                          NC_000008.11:27604053:T:A
                          Gene:
                          CLU (Varview)
                          Functional Consequence:
                          intron_variant
                          Validated:
                          by frequency,by alfa,by cluster
                          MAF:
                          A=0.000142/2 (ALFA)
                          A=0./0 (TWINSUK)
                          A=0.000102/27 (TOPMED)
                          A=0.000107/15 (GnomAD)
                          A=0.000259/1 (ALSPAC)
                          HGVS:
                          13.

                          rs781182159 [Homo sapiens]
                            Variant type:
                            SNV
                            Alleles:
                            A>G [Show Flanks]
                            Chromosome:
                            8:27606462 (GRCh38)
                            8:27463979 (GRCh37)
                            Canonical SPDI:
                            NC_000008.11:27606461:A:G
                            Gene:
                            CLU (Varview)
                            Functional Consequence:
                            coding_sequence_variant,non_coding_transcript_variant,synonymous_variant
                            Validated:
                            by frequency,by cluster
                            MAF:
                            G=0.000004/1 (GnomAD_exomes)
                            G=0.000008/1 (ExAC)
                            HGVS:
                            14.

                            rs781050868 has merged into rs776835353 [Homo sapiens]
                              Variant type:
                              DELINS
                              Alleles:
                              AGGAAAGGCCCGC>-,AGGAAAGGCCCGCAGGAAAGGCCCGC [Show Flanks]
                              Chromosome:
                              8:27598439 (GRCh38)
                              8:27455956 (GRCh37)
                              Canonical SPDI:
                              NC_000008.11:27598430:AGGCCCGCAGGAAAGGCCCGC:AGGCCCGC,NC_000008.11:27598430:AGGCCCGCAGGAAAGGCCCGC:AGGCCCGCAGGAAAGGCCCGCAGGAAAGGCCCGC
                              Gene:
                              CLU (Varview)
                              Functional Consequence:
                              intron_variant
                              Validated:
                              by frequency,by alfa,by cluster
                              MAF:
                              AGGCCCGCAGGAAAGGCCCGCAGGAAAGGCCCGC=0.000071/1 (ALFA)
                              AGGCCCGCAGGAA=0.000004/1 (GnomAD_exomes)
                              AGGCCCGCAGGAA=0.000004/1 (TOPMED)
                              AGGCCCGCAGGAA=0.000007/1 (GnomAD)
                              AGGCCCGCAGGAA=0.000008/1 (ExAC)
                              HGVS:
                              15.

                              rs780973710 [Homo sapiens]
                                Variant type:
                                SNV
                                Alleles:
                                G>C [Show Flanks]
                                Chromosome:
                                8:27600065 (GRCh38)
                                8:27457582 (GRCh37)
                                Canonical SPDI:
                                NC_000008.11:27600064:G:C
                                Gene:
                                CLU (Varview)
                                Functional Consequence:
                                intron_variant
                                Validated:
                                by frequency,by alfa,by cluster
                                MAF:
                                C=0./0 (ALFA)
                                C=0.000007/1 (GnomAD)
                                C=0.000009/1 (ExAC)
                                C=0.000013/3 (GnomAD_exomes)
                                HGVS:
                                16.

                                rs780875416 [Homo sapiens]
                                  Variant type:
                                  SNV
                                  Alleles:
                                  C>A,T [Show Flanks]
                                  Chromosome:
                                  8:27610509 (GRCh38)
                                  8:27468026 (GRCh37)
                                  Canonical SPDI:
                                  NC_000008.11:27610508:C:A,NC_000008.11:27610508:C:T
                                  Gene:
                                  CLU (Varview), MIR6843 (Varview)
                                  Functional Consequence:
                                  downstream_transcript_variant,500B_downstream_variant,coding_sequence_variant,non_coding_transcript_variant,synonymous_variant
                                  Validated:
                                  by frequency,by alfa,by cluster
                                  MAF:
                                  A=0./0 (ALFA)
                                  A=0.000004/1 (GnomAD_exomes)
                                  A=0.000007/1 (GnomAD)
                                  A=0.000008/1 (ExAC)
                                  A=0.000008/2 (TOPMED)
                                  HGVS:
                                  17.

                                  rs780867922 [Homo sapiens]
                                    Variant type:
                                    DELINS
                                    Alleles:
                                    AAAA>-,A,AA,AAA,AAAAA,AAAAAA,AAAAAAAAA [Show Flanks]
                                    Chromosome:
                                    8:27602614 (GRCh38)
                                    8:27460131 (GRCh37)
                                    Canonical SPDI:
                                    NC_000008.11:27602600:AAAAAAAAAAAAAAAAA:AAAAAAAAAAAAA,NC_000008.11:27602600:AAAAAAAAAAAAAAAAA:AAAAAAAAAAAAAA,NC_000008.11:27602600:AAAAAAAAAAAAAAAAA:AAAAAAAAAAAAAAA,NC_000008.11:27602600:AAAAAAAAAAAAAAAAA:AAAAAAAAAAAAAAAA,NC_000008.11:27602600:AAAAAAAAAAAAAAAAA:AAAAAAAAAAAAAAAAAA,NC_000008.11:27602600:AAAAAAAAAAAAAAAAA:AAAAAAAAAAAAAAAAAAA,NC_000008.11:27602600:AAAAAAAAAAAAAAAAA:AAAAAAAAAAAAAAAAAAAAAA
                                    Gene:
                                    CLU (Varview)
                                    Functional Consequence:
                                    intron_variant
                                    Validated:
                                    by frequency,by alfa,by cluster
                                    MAF:
                                    AAAAAAAAAAAAAAA=0./0 (ALFA)
                                    -=0.325/13 (GENOME_DK)
                                    HGVS:
                                    18.

                                    rs780858365 [Homo sapiens]
                                      Variant type:
                                      SNV
                                      Alleles:
                                      G>A [Show Flanks]
                                      Chromosome:
                                      8:27608920 (GRCh38)
                                      8:27466437 (GRCh37)
                                      Canonical SPDI:
                                      NC_000008.11:27608919:G:A
                                      Gene:
                                      CLU (Varview)
                                      Functional Consequence:
                                      intron_variant
                                      Validated:
                                      by frequency,by alfa,by cluster
                                      MAF:
                                      A=0.000043/1 (ALFA)
                                      A=0.000004/1 (GnomAD_exomes)
                                      A=0.000008/1 (ExAC)
                                      A=0.000011/3 (TOPMED)
                                      A=0.000014/2 (GnomAD)
                                      HGVS:
                                      19.

                                      rs780805217 [Homo sapiens]
                                        Variant type:
                                        SNV
                                        Alleles:
                                        C>A,T [Show Flanks]
                                        Chromosome:
                                        8:27600762 (GRCh38)
                                        8:27458279 (GRCh37)
                                        Canonical SPDI:
                                        NC_000008.11:27600761:C:A,NC_000008.11:27600761:C:T
                                        Gene:
                                        CLU (Varview)
                                        Functional Consequence:
                                        intron_variant
                                        Validated:
                                        by frequency,by cluster
                                        MAF:
                                        A=0.0005/1 (Korea1K)
                                        HGVS:
                                        20.

                                        rs780796469 [Homo sapiens]
                                          Variant type:
                                          SNV
                                          Alleles:
                                          T>A [Show Flanks]
                                          Chromosome:
                                          8:27616355 (GRCh38)
                                          8:27473872 (GRCh37)
                                          Canonical SPDI:
                                          NC_000008.11:27616354:T:A
                                          Gene:
                                          CLU (Varview)
                                          Functional Consequence:
                                          upstream_transcript_variant,2KB_upstream_variant
                                          Validated:
                                          by frequency,by alfa,by cluster
                                          MAF:
                                          A=0./0 (ALFA)
                                          A=0.000004/1 (TOPMED)
                                          HGVS:

                                          Display Settings:

                                          Format
                                          Items per page
                                          Sort by

                                          Send to:

                                          Choose Destination

                                          Supplemental Content

                                          Find related data

                                          Recent activity

                                          Support Center