Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PMC

Items: 6

1.

rs35822681 [Homo sapiens]
    Variant type:
    DELINS
    Alleles:
    ->GTAT,GTATAT,GTATATAT,GTATATGTGTGTGTGTGTGTGTAT,GTGTAT,GTGTATGTAT,GTGTGTAT,GTGTGTATAT,GTGTGTATATAT,GTGTGTGTAT,GTGTGTGTATAT,GTGTGTGTATATAT,GTGTGTGTGTAT,GTGTGTGTGTATAT,GTGTGTGTGTATATAT,GTGTGTGTGTGTAT,GTGTGTGTGTGTATAT,GTGTGTGTGTGTGTAT,GTGTGTGTGTGTGTATAT,GTGTGTGTGTGTGTGTAT,GTGTGTGTGTGTGTGTGTGTAT,TGTGTGTGTGTATAT [Show Flanks]
    Chromosome:
    20:18488971 (GRCh38)
    20:18469616 (GRCh37)
    Canonical SPDI:
    NC_000020.11:18488971:T:TGTAT,NC_000020.11:18488971:T:TGTATAT,NC_000020.11:18488971:T:TGTATATAT,NC_000020.11:18488971:T:TGTATATGTGTGTGTGTGTGTGTAT,NC_000020.11:18488971:T:TGTGTAT,NC_000020.11:18488971:T:TGTGTATGTAT,NC_000020.11:18488971:T:TGTGTGTAT,NC_000020.11:18488971:T:TGTGTGTATAT,NC_000020.11:18488971:T:TGTGTGTATATAT,NC_000020.11:18488971:T:TGTGTGTGTAT,NC_000020.11:18488971:T:TGTGTGTGTATAT,NC_000020.11:18488971:T:TGTGTGTGTATATAT,NC_000020.11:18488971:T:TGTGTGTGTGTAT,NC_000020.11:18488971:T:TGTGTGTGTGTATAT,NC_000020.11:18488971:T:TGTGTGTGTGTATATAT,NC_000020.11:18488971:T:TGTGTGTGTGTGTAT,NC_000020.11:18488971:T:TGTGTGTGTGTGTATAT,NC_000020.11:18488971:T:TGTGTGTGTGTGTGTAT,NC_000020.11:18488971:T:TGTGTGTGTGTGTGTATAT,NC_000020.11:18488971:T:TGTGTGTGTGTGTGTGTAT,NC_000020.11:18488971:T:TGTGTGTGTGTGTGTGTGTGTAT,NC_000020.11:18488971:T:TTGTGTGTGTGTATAT
    Gene:
    RBBP9 (Varview)
    Functional Consequence:
    3_prime_UTR_variant
    Validated:
    by frequency,by alfa,by cluster
    MAF:
    TGTATATAT=0./0 (ALFA)
    TGTATATGTGTGTGTGTGTGTGTA=0.000004/1 (TOPMED)
    TGTGTGTGTA=0.475/19 (GENOME_DK)
    HGVS:
    NC_000020.11:g.18488972_18488973insGTAT, NC_000020.11:g.18488972_18488973insGTATAT, NC_000020.11:g.18488972_18488973insGTATATAT, NC_000020.11:g.18488972_18488973insGTATATGTGTGTGTGTGTGTGTAT, NC_000020.11:g.18488972TG[2]TAT[1], NC_000020.11:g.18488972TG[2]TATGTAT[1], NC_000020.11:g.18488972TG[3]TAT[1], NC_000020.11:g.18488972TG[3]TA[2]T[1], NC_000020.11:g.18488972TG[3]TA[3]T[1], NC_000020.11:g.18488972TG[4]TAT[1], NC_000020.11:g.18488972TG[4]TA[2]T[1], NC_000020.11:g.18488972TG[4]TA[3]T[1], NC_000020.11:g.18488972TG[5]TAT[1], NC_000020.11:g.18488972TG[5]TA[2]T[1], NC_000020.11:g.18488972TG[5]TA[3]T[1], NC_000020.11:g.18488972TG[6]TAT[1], NC_000020.11:g.18488972TG[6]TA[2]T[1], NC_000020.11:g.18488972TG[7]TAT[1], NC_000020.11:g.18488972TG[7]TA[2]T[1], NC_000020.11:g.18488972TG[8]TAT[1], NC_000020.11:g.18488972TG[10]TAT[1], NC_000020.11:g.18488972_18488973insTGTGTGTGTGTATAT, NC_000020.10:g.18469616_18469617insGTAT, NC_000020.10:g.18469616_18469617insGTATAT, NC_000020.10:g.18469616_18469617insGTATATAT, NC_000020.10:g.18469616_18469617insGTATATGTGTGTGTGTGTGTGTAT, NC_000020.10:g.18469616TG[2]TAT[1], NC_000020.10:g.18469616TG[2]TATGTAT[1], NC_000020.10:g.18469616TG[3]TAT[1], NC_000020.10:g.18469616TG[3]TA[2]T[1], NC_000020.10:g.18469616TG[3]TA[3]T[1], NC_000020.10:g.18469616TG[4]TAT[1], NC_000020.10:g.18469616TG[4]TA[2]T[1], NC_000020.10:g.18469616TG[4]TA[3]T[1], NC_000020.10:g.18469616TG[5]TAT[1], NC_000020.10:g.18469616TG[5]TA[2]T[1], NC_000020.10:g.18469616TG[5]TA[3]T[1], NC_000020.10:g.18469616TG[6]TAT[1], NC_000020.10:g.18469616TG[6]TA[2]T[1], NC_000020.10:g.18469616TG[7]TAT[1], NC_000020.10:g.18469616TG[7]TA[2]T[1], NC_000020.10:g.18469616TG[8]TAT[1], NC_000020.10:g.18469616TG[10]TAT[1], NC_000020.10:g.18469616_18469617insTGTGTGTGTGTATAT, NM_006606.3:c.*792_*793insTACA, NM_006606.3:c.*792AT[2]ACA[1], NM_006606.3:c.*792AT[3]ACA[1], NM_006606.3:c.*792_*793insTACACACACACACACACATATACA, NM_006606.3:c.*792_*793insTACACA, NM_006606.3:c.*792ATAC[2]ACA[1], NM_006606.3:c.*792_*793insTACACACA, NM_006606.3:c.*792AT[2]AC[3]A[1], NM_006606.3:c.*792AT[3]AC[3]A[1], NM_006606.3:c.*792_*793insTACACACACA, NM_006606.3:c.*792AT[2]AC[4]A[1], NM_006606.3:c.*792AT[3]AC[4]A[1], NM_006606.3:c.*792_*793insTACACACACACA, NM_006606.3:c.*792AT[2]AC[5]A[1], NM_006606.3:c.*792AT[3]AC[5]A[1], NM_006606.3:c.*792_*793insTACACACACACACA, NM_006606.3:c.*792AT[2]AC[6]A[1], NM_006606.3:c.*792_*793insTACACACACACACACA, NM_006606.3:c.*792AT[2]AC[7]A[1], NM_006606.3:c.*792_*793insTACACACACACACACACA, NM_006606.3:c.*792_*793insTACACACACACACACACACACA, NM_006606.3:c.*792AT[2]AC[5]AA[1], NM_006606.2:c.*792_*793insTACA, NM_006606.2:c.*792AT[2]ACA[1], NM_006606.2:c.*792AT[3]ACA[1], NM_006606.2:c.*792_*793insTACACACACACACACACATATACA, NM_006606.2:c.*792_*793insTACACA, NM_006606.2:c.*792ATAC[2]ACA[1], NM_006606.2:c.*792_*793insTACACACA, NM_006606.2:c.*792AT[2]AC[3]A[1], NM_006606.2:c.*792AT[3]AC[3]A[1], NM_006606.2:c.*792_*793insTACACACACA, NM_006606.2:c.*792AT[2]AC[4]A[1], NM_006606.2:c.*792AT[3]AC[4]A[1], NM_006606.2:c.*792_*793insTACACACACACA, NM_006606.2:c.*792AT[2]AC[5]A[1], NM_006606.2:c.*792AT[3]AC[5]A[1], NM_006606.2:c.*792_*793insTACACACACACACA, NM_006606.2:c.*792AT[2]AC[6]A[1], NM_006606.2:c.*792_*793insTACACACACACACACA, NM_006606.2:c.*792AT[2]AC[7]A[1], NM_006606.2:c.*792_*793insTACACACACACACACACA, NM_006606.2:c.*792_*793insTACACACACACACACACACACA, NM_006606.2:c.*792AT[2]AC[5]AA[1], XM_005260652.2:c.*792_*793insTACA, XM_005260652.2:c.*792AT[2]ACA[1], XM_005260652.2:c.*792AT[3]ACA[1], XM_005260652.2:c.*792_*793insTACACACACACACACACATATACA, XM_005260652.2:c.*792_*793insTACACA, XM_005260652.2:c.*792ATAC[2]ACA[1], XM_005260652.2:c.*792_*793insTACACACA, XM_005260652.2:c.*792AT[2]AC[3]A[1], XM_005260652.2:c.*792AT[3]AC[3]A[1], XM_005260652.2:c.*792_*793insTACACACACA, XM_005260652.2:c.*792AT[2]AC[4]A[1], XM_005260652.2:c.*792AT[3]AC[4]A[1], XM_005260652.2:c.*792_*793insTACACACACACA, XM_005260652.2:c.*792AT[2]AC[5]A[1], XM_005260652.2:c.*792AT[3]AC[5]A[1], XM_005260652.2:c.*792_*793insTACACACACACACA, XM_005260652.2:c.*792AT[2]AC[6]A[1], XM_005260652.2:c.*792_*793insTACACACACACACACA, XM_005260652.2:c.*792AT[2]AC[7]A[1], XM_005260652.2:c.*792_*793insTACACACACACACACACA, XM_005260652.2:c.*792_*793insTACACACACACACACACACACA, XM_005260652.2:c.*792AT[2]AC[5]AA[1], XM_005260652.1:c.*792_*793insTACA, XM_005260652.1:c.*792AT[2]ACA[1], XM_005260652.1:c.*792AT[3]ACA[1], XM_005260652.1:c.*792_*793insTACACACACACACACACATATACA, XM_005260652.1:c.*792_*793insTACACA, XM_005260652.1:c.*792ATAC[2]ACA[1], XM_005260652.1:c.*792_*793insTACACACA, XM_005260652.1:c.*792AT[2]AC[3]A[1], XM_005260652.1:c.*792AT[3]AC[3]A[1], XM_005260652.1:c.*792_*793insTACACACACA, XM_005260652.1:c.*792AT[2]AC[4]A[1], XM_005260652.1:c.*792AT[3]AC[4]A[1], XM_005260652.1:c.*792_*793insTACACACACACA, XM_005260652.1:c.*792AT[2]AC[5]A[1], XM_005260652.1:c.*792AT[3]AC[5]A[1], XM_005260652.1:c.*792_*793insTACACACACACACA, XM_005260652.1:c.*792AT[2]AC[6]A[1], XM_005260652.1:c.*792_*793insTACACACACACACACA, XM_005260652.1:c.*792AT[2]AC[7]A[1], XM_005260652.1:c.*792_*793insTACACACACACACACACA, XM_005260652.1:c.*792_*793insTACACACACACACACACACACA, XM_005260652.1:c.*792AT[2]AC[5]AA[1], NM_153328.1:c.*792_*793insTACA, NM_153328.1:c.*792AT[2]ACA[1], NM_153328.1:c.*792AT[3]ACA[1], NM_153328.1:c.*792_*793insTACACACACACACACACATATACA, NM_153328.1:c.*792_*793insTACACA, NM_153328.1:c.*792ATAC[2]ACA[1], NM_153328.1:c.*792_*793insTACACACA, NM_153328.1:c.*792AT[2]AC[3]A[1], NM_153328.1:c.*792AT[3]AC[3]A[1], NM_153328.1:c.*792_*793insTACACACACA, NM_153328.1:c.*792AT[2]AC[4]A[1], NM_153328.1:c.*792AT[3]AC[4]A[1], NM_153328.1:c.*792_*793insTACACACACACA, NM_153328.1:c.*792AT[2]AC[5]A[1], NM_153328.1:c.*792AT[3]AC[5]A[1], NM_153328.1:c.*792_*793insTACACACACACACA, NM_153328.1:c.*792AT[2]AC[6]A[1], NM_153328.1:c.*792_*793insTACACACACACACACA, NM_153328.1:c.*792AT[2]AC[7]A[1], NM_153328.1:c.*792_*793insTACACACACACACACACA, NM_153328.1:c.*792_*793insTACACACACACACACACACACA, NM_153328.1:c.*792AT[2]AC[5]AA[1]
    2.

    rs11696919 [Homo sapiens]
      Variant type:
      SNV
      Alleles:
      T>C [Show Flanks]
      Chromosome:
      20:23047426 (GRCh38)
      20:23028063 (GRCh37)
      Canonical SPDI:
      NC_000020.11:23047425:T:C
      Gene:
      THBD (Varview)
      Functional Consequence:
      3_prime_UTR_variant
      Clinical significance:
      benign
      Validated:
      by frequency,by alfa,by cluster
      MAF:
      C=0.046952/901 (ALFA)
      C=0.019169/96 (1000Genomes)
      C=0.025/1 (GENOME_DK)
      C=0.026667/16 (NorthernSweden)
      C=0.037037/8 (Qatari)
      C=0.039888/10558 (TOPMED)
      C=0.040284/5648 (GnomAD)
      C=0.045982/206 (Estonian)
      C=0.060197/232 (ALSPAC)
      C=0.063126/63 (GoNL)
      C=0.063646/236 (TWINSUK)
      T=0.5/10 (SGDP_PRJ)
      T=0.5/5 (Siberian)
      HGVS:
      3.

      rs6111803 [Homo sapiens]
        Variant type:
        SNV
        Alleles:
        G>T [Show Flanks]
        Chromosome:
        20:18041718 (GRCh38)
        20:18022362 (GRCh37)
        Canonical SPDI:
        NC_000020.11:18041717:G:T
        Gene:
        OVOL2 (Varview)
        Functional Consequence:
        coding_sequence_variant,5_prime_UTR_variant,synonymous_variant
        Validated:
        by frequency,by alfa,by cluster
        MAF:
        T=0.059688/10548 (ALFA)
        T=0.000776/13 (TOMMO)
        T=0.001369/4 (KOREAN)
        T=0.02/6 (FINRISK)
        T=0.026217/14 (MGP)
        T=0.027778/6 (Qatari)
        T=0.029241/131 (Estonian)
        T=0.040335/202 (1000Genomes)
        T=0.042973/74 (HapMap)
        T=0.043459/10855 (GnomAD_exomes)
        T=0.044676/5324 (ExAC)
        T=0.046039/3623 (PAGE_STUDY)
        T=0.058098/15378 (TOPMED)
        T=0.058546/8195 (GnomAD)
        T=0.069968/910 (GoESP)
        T=0.07/42 (NorthernSweden)
        T=0.071142/71 (GoNL)
        T=0.075246/290 (ALSPAC)
        T=0.075782/281 (TWINSUK)
        G=0.5/18 (SGDP_PRJ)
        G=0.5/2 (Siberian)
        HGVS:
        4.

        rs6089151 [Homo sapiens]
          Variant type:
          SNV
          Alleles:
          G>A,T [Show Flanks]
          Chromosome:
          20:32029032 (GRCh38)
          20:30616835 (GRCh37)
          Canonical SPDI:
          NC_000020.11:32029031:G:A,NC_000020.11:32029031:G:T
          Gene:
          CCM2L (Varview)
          Functional Consequence:
          coding_sequence_variant,synonymous_variant,missense_variant
          Validated:
          by frequency,by alfa,by cluster
          MAF:
          A=0.049214/5259 (ALFA)
          A=0.011696/8 (HapMap)
          A=0.015355/32 (HGDP_Stanford)
          A=0.01877/94 (1000Genomes)
          A=0.019796/1558 (PAGE_STUDY)
          A=0.023148/5 (Qatari)
          A=0.034214/9056 (TOPMED)
          A=0.038333/23 (NorthernSweden)
          A=0.038526/5402 (GnomAD)
          A=0.04052/527 (GoESP)
          A=0.042553/4 (PRJEB36033)
          A=0.054229/209 (ALSPAC)
          A=0.055016/204 (TWINSUK)
          A=0.063126/63 (GoNL)
          A=0.065848/295 (Estonian)
          A=0.069079/21 (FINRISK)
          A=0.074906/40 (MGP)
          G=0.5/1 (Siberian)
          G=0.5/5 (SGDP_PRJ)
          HGVS:
          5.

          rs6045164 [Homo sapiens]
            Variant type:
            SNV
            Alleles:
            T>A,G [Show Flanks]
            Chromosome:
            20:18050811 (GRCh38)
            20:18031455 (GRCh37)
            Canonical SPDI:
            NC_000020.11:18050810:T:A,NC_000020.11:18050810:T:G
            Gene:
            OVOL2 (Varview)
            Functional Consequence:
            intron_variant
            Validated:
            by frequency,by alfa,by cluster
            MAF:
            A=0.021791/382 (ALFA)
            A=0.000776/13 (TOMMO)
            A=0.001027/3 (KOREAN)
            A=0.027778/6 (Qatari)
            A=0.029464/132 (Estonian)
            A=0.040935/205 (1000Genomes)
            A=0.045386/60 (HapMap)
            A=0.05/2 (GENOME_DK)
            A=0.058197/8158 (GnomAD)
            A=0.068333/41 (NorthernSweden)
            A=0.071142/71 (GoNL)
            A=0.072652/280 (ALSPAC)
            A=0.074164/275 (TWINSUK)
            T=0.5/17 (SGDP_PRJ)
            T=0.5/2 (Siberian)
            HGVS:
            6.

            rs3838038 [Homo sapiens]
              Variant type:
              DEL
              Alleles:
              TAAAAAAAA>- [Show Flanks]
              Chromosome:
              20:32072563 (GRCh38)
              20:30660366 (GRCh37)
              Canonical SPDI:
              NC_000020.11:32072562:TAAAAAAAA:
              Gene:
              HCK (Varview)
              Functional Consequence:
              intron_variant
              Validated:
              by frequency,by alfa,by cluster
              MAF:
              -=0.09594/1138 (ALFA)
              -=0.03236/120 (TWINSUK)
              -=0.03347/129 (ALSPAC)
              -=0.08126/1340 (TOMMO)
              -=0.13671/13511 (GnomAD)
              HGVS:

              Display Settings:

              Format
              Items per page
              Sort by

              Send to:

              Choose Destination

              Supplemental Content

              Find related data

              Recent activity

              Your browsing activity is empty.

              Activity recording is turned off.

              Turn recording back on

              See more...
              Support Center