Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Search results

Items: 1 to 20 of 24669317

1.

rs248 [Homo sapiens]
    Variant type:
    SNV
    Alleles:
    G>A [Show Flanks]
    Chromosome:
    8:19953315 (GRCh38)
    8:19810826 (GRCh37)
    Canonical SPDI:
    NC_000008.11:19953314:G:A
    Gene:
    LPL (Varview)
    Functional Consequence:
    synonymous_variant,coding_sequence_variant
    Clinical significance:
    benign,likely-benign
    Validated:
    by frequency,by alfa,by cluster
    MAF:
    A=0.066614/1593 (ALFA)
    A=0.030488/10 (HapMap)
    A=0.038738/194 (1000Genomes)
    A=0.046296/10 (Qatari)
    A=0.048689/26 (MGP)
    A=0.049866/12534 (GnomAD_exomes)
    A=0.05/2 (GENOME_DK)
    A=0.051312/6226 (ExAC)
    A=0.055356/6951 (TOPMED)
    A=0.065431/851 (GoESP)
    A=0.065789/20 (FINRISK)
    A=0.066907/2101 (GnomAD)
    A=0.068136/68 (GoNL)
    A=0.06876/265 (ALSPAC)
    A=0.072816/270 (TWINSUK)
    A=0.081667/49 (NorthernSweden)
    A=0.121429/544 (Estonian)
    G=0.444444/8 (SGDP_PRJ)
    G=0.5/2 (Siberian)
    HGVS:
    2.

    rs316 [Homo sapiens]
      Variant type:
      SNV
      Alleles:
      C>A,G,T [Show Flanks]
      Chromosome:
      8:19960925 (GRCh38)
      8:19818436 (GRCh37)
      Canonical SPDI:
      NC_000008.11:19960924:C:A,NC_000008.11:19960924:C:G,NC_000008.11:19960924:C:T
      Gene:
      LPL (Varview)
      Functional Consequence:
      synonymous_variant,coding_sequence_variant
      Clinical significance:
      likely-benign
      Validated:
      by frequency,by alfa,by cluster
      MAF:
      A=0.132282/16939 (ALFA)
      A=0.081332/149 (Korea1K)
      A=0.081433/50 (Vietnamese)
      A=0.0843/247 (KOREAN)
      A=0.099251/53 (MGP)
      A=0.112224/112 (GoNL)
      A=0.115965/430 (TWINSUK)
      A=0.125/5 (GENOME_DK)
      A=0.126667/76 (NorthernSweden)
      A=0.127141/490 (ALSPAC)
      A=0.143474/299 (HGDP_Stanford)
      A=0.150583/284 (HapMap)
      A=0.152556/764 (1000Genomes)
      A=0.154605/47 (FINRISK)
      A=0.15581/177 (Daghestan)
      A=0.155955/19583 (TOPMED)
      A=0.158619/2063 (GoESP)
      A=0.159943/5011 (GnomAD)
      A=0.162037/35 (Qatari)
      A=0.162071/12755 (PAGE_STUDY)
      A=0.169866/761 (Estonian)
      C=0.415493/59 (SGDP_PRJ)
      C=0.5/7 (Siberian)
      HGVS:
      3.

      rs326 [Homo sapiens]
        Variant type:
        SNV
        Alleles:
        A>G [Show Flanks]
        Chromosome:
        8:19961928 (GRCh38)
        8:19819439 (GRCh37)
        Canonical SPDI:
        NC_000008.11:19961927:A:G
        Gene:
        LPL (Varview)
        Functional Consequence:
        intron_variant
        Clinical significance:
        association
        Validated:
        by frequency,by alfa,by cluster
        MAF:
        G=0.318007/29838 (ALFA)
        G=0.014981/8 (MGP)
        G=0.180556/39 (Vietnamese)
        G=0.201965/370 (Korea1K)
        G=0.208532/611 (KOREAN)
        G=0.225/9 (GENOME_DK)
        G=0.263333/158 (NorthernSweden)
        G=0.272768/1222 (Estonian)
        G=0.28754/180 (Chileans)
        G=0.29398/1133 (ALSPAC)
        G=0.295577/1096 (TWINSUK)
        G=0.295591/295 (GoNL)
        G=0.317138/359 (Daghestan)
        G=0.349441/1750 (1000Genomes)
        G=0.358872/11237 (GnomAD)
        G=0.376298/47251 (TOPMED)
        A=0.39/117 (SGDP_PRJ)
        G=0.392178/742 (HapMap)
        G=0.392347/30873 (PAGE_STUDY)
        G=0.412037/89 (Qatari)
        A=0.5/11 (Siberian)
        HGVS:
        4.

        rs328 [Homo sapiens]
          Variant type:
          SNV
          Alleles:
          C>A,G [Show Flanks]
          Chromosome:
          8:19962213 (GRCh38)
          8:19819724 (GRCh37)
          Canonical SPDI:
          NC_000008.11:19962212:C:A,NC_000008.11:19962212:C:G
          Gene:
          LPL (Varview)
          Functional Consequence:
          stop_gained,coding_sequence_variant
          Clinical significance:
          benign,likely-benign
          Validated:
          by frequency,by alfa,by cluster
          MAF:
          G=0.103615/1158 (ALFA)
          G=0.066964/300 (Estonian)
          G=0.074074/16 (Qatari)
          G=0.07904/6220 (PAGE_STUDY)
          G=0.085/51 (NorthernSweden)
          G=0.086979/2728 (GnomAD)
          G=0.089712/11265 (TOPMED)
          G=0.091711/104 (Daghestan)
          G=0.092105/28 (FINRISK)
          G=0.092156/23148 (GnomAD_exomes)
          G=0.092452/463 (1000Genomes)
          G=0.093501/11340 (ExAC)
          G=0.097561/32 (HapMap)
          G=0.1/4 (GENOME_DK)
          G=0.106642/411 (ALSPAC)
          G=0.107875/400 (TWINSUK)
          G=0.118236/118 (GoNL)
          G=0.120819/354 (KOREAN)
          G=0.127036/78 (Vietnamese)
          G=0.151685/81 (MGP)
          C=0.473684/36 (SGDP_PRJ)
          C=0.5/3 (Siberian)
          HGVS:
          5.

          rs333 [Homo sapiens]
            Variant type:
            DELINS
            Alleles:
            GTCAGTATCAATTCTGGAAGAATTTCCAGACA>- [Show Flanks]
            Chromosome:
            3:46373453 (GRCh38)
            3:46414944 (GRCh37)
            Canonical SPDI:
            NC_000003.12:46373452:ACAGTCAGTATCAATTCTGGAAGAATTTCCAGACA:ACA
            Gene:
            CCR5 (Varview), CCR5AS (Varview)
            Functional Consequence:
            intron_variant,coding_sequence_variant,frameshift_variant
            Clinical significance:
            risk-factor,protective,benign
            Validated:
            by frequency,by alfa,by cluster
            MAF:
            ACA=0.101246/910 (ALFA)
            -=0.00463/1 (Vietnamese)
            -=0.024652/1940 (PAGE_STUDY)
            -=0.029153/146 (1000Genomes)
            -=0.060429/755 (GoESP)
            -=0.072628/8805 (ExAC)
            -=0.074164/275 (TWINSUK)
            -=0.074261/18640 (GnomAD_exomes)
            -=0.077421/2427 (GnomAD)
            -=0.093669/361 (ALSPAC)
            -=0.106667/64 (NorthernSweden)
            -=0.117857/528 (Estonian)
            -=0.25/10 (GENOME_DK)
            HGVS:
            6.

            rs334 [Homo sapiens]
              Variant type:
              SNV
              Alleles:
              T>A,C,G [Show Flanks]
              Chromosome:
              11:5227002 (GRCh38)
              11:5248232 (GRCh37)
              Canonical SPDI:
              NC_000011.10:5227001:T:A,NC_000011.10:5227001:T:C,NC_000011.10:5227001:T:G
              Gene:
              HBB (Varview)
              Functional Consequence:
              missense_variant,coding_sequence_variant
              Clinical significance:
              protective,pathogenic,other
              Validated:
              by frequency,by alfa,by cluster
              MAF:
              A=0.000716/8 (ALFA)
              G=0.000546/1 (Korea1K)
              G=0.001711/5 (KOREAN)
              A=0.00348/874 (GnomAD_exomes)
              A=0.004384/532 (ExAC)
              A=0.011529/362 (GnomAD)
              A=0.018519/4 (Qatari)
              A=0.027356/137 (1000Genomes)
              A=0.040373/13 (HapMap)
              T=0.5/5 (SGDP_PRJ)
              HGVS:
              7.

              rs544 [Homo sapiens]
                Variant type:
                SNV
                Alleles:
                A>C,G [Show Flanks]
                Chromosome:
                5:10264850 (GRCh38)
                5:10264962 (GRCh37)
                Canonical SPDI:
                NC_000005.10:10264849:A:C,NC_000005.10:10264849:A:G
                Gene:
                CCT5 (Varview)
                Functional Consequence:
                3_prime_UTR_variant
                Clinical significance:
                benign
                Validated:
                by frequency,by alfa,by cluster
                MAF:
                A=0.220347/1449 (ALFA)
                A=0.05/2 (GENOME_DK)
                A=0.053571/3 (Siberian)
                A=0.094198/276 (KOREAN)
                A=0.110487/59 (MGP)
                A=0.126667/76 (NorthernSweden)
                A=0.134598/603 (Estonian)
                A=0.141412/545 (ALSPAC)
                A=0.147789/548 (TWINSUK)
                A=0.148148/32 (Vietnamese)
                A=0.149299/149 (GoNL)
                A=0.178431/91 (SGDP_PRJ)
                A=0.208333/45 (Qatari)
                A=0.256837/8058 (GnomAD)
                A=0.266835/33506 (TOPMED)
                A=0.314297/1574 (1000Genomes)
                A=0.354893/631 (HapMap)
                HGVS:
                8.

                rs551 [Homo sapiens]
                  Variant type:
                  SNV
                  Alleles:
                  G>A,C,T [Show Flanks]
                  Chromosome:
                  4:109740781 (GRCh38)
                  4:110661937 (GRCh37)
                  Canonical SPDI:
                  NC_000004.12:109740780:G:A,NC_000004.12:109740780:G:C,NC_000004.12:109740780:G:T
                  Gene:
                  CFI (Varview)
                  Functional Consequence:
                  3_prime_UTR_variant,genic_downstream_transcript_variant,intron_variant,downstream_transcript_variant,non_coding_transcript_variant
                  Clinical significance:
                  benign
                  Validated:
                  by frequency,by alfa,by cluster
                  MAF:
                  G=0.015011/1259 (ALFA)
                  G=0./0 (ALSPAC)
                  G=0./0 (GENOME_DK)
                  C=0./0 (KOREAN)
                  G=0./0 (Korea1K)
                  G=0./0 (NorthernSweden)
                  G=0./0 (Siberian)
                  G=0./0 (TWINSUK)
                  G=0./0 (Vietnamese)
                  G=0.010723/1926 (GnomAD_exomes)
                  G=0.011832/678 (ExAC)
                  G=0.019713/11 (SGDP_PRJ)
                  G=0.045683/1435 (GnomAD)
                  G=0.046326/232 (1000Genomes)
                  G=0.050387/6327 (TOPMED)
                  G=0.064815/14 (Qatari)
                  G=0.123246/123 (HapMap)
                  G=0.17603/94 (MGP)
                  HGVS:
                  NC_000004.12:g.109740781G>A, NC_000004.12:g.109740781G>C, NC_000004.12:g.109740781G>T, NC_000004.11:g.110661937G>A, NC_000004.11:g.110661937G>C, NC_000004.11:g.110661937G>T, NG_007569.1:g.66205C>T, NG_007569.1:g.66205C>G, NG_007569.1:g.66205C>A, NM_000204.5:c.*112C>T, NM_000204.5:c.*112C>G, NM_000204.5:c.*112C>A, NM_000204.4:c.*112C>T, NM_000204.4:c.*112C>G, NM_000204.4:c.*112C>A, NM_000204.3:c.*112C>T, NM_000204.3:c.*112C>G, NM_000204.3:c.*112C>A, NM_001318057.2:c.*112C>T, NM_001318057.2:c.*112C>G, NM_001318057.2:c.*112C>A, NM_001318057.1:c.*112C>T, NM_001318057.1:c.*112C>G, NM_001318057.1:c.*112C>A, NM_001331035.2:c.*112C>T, NM_001331035.2:c.*112C>G, NM_001331035.2:c.*112C>A, NM_001331035.1:c.*112C>T, NM_001331035.1:c.*112C>G, NM_001331035.1:c.*112C>A, NR_164672.1:n.1914C>T, NR_164672.1:n.1914C>G, NR_164672.1:n.1914C>A, NR_164673.1:n.1888C>T, NR_164673.1:n.1888C>G, NR_164673.1:n.1888C>A, NM_001375283.1:c.*112C>T, NM_001375283.1:c.*112C>G, NM_001375283.1:c.*112C>A, NR_164671.1:n.1611C>T, NR_164671.1:n.1611C>G, NR_164671.1:n.1611C>A, NM_001375284.1:c.*112C>T, NM_001375284.1:c.*112C>G, NM_001375284.1:c.*112C>A
                  9.

                  rs553 [Homo sapiens]
                    Variant type:
                    SNV
                    Alleles:
                    G>A,T [Show Flanks]
                    Chromosome:
                    6:131890900 (GRCh38)
                    6:132212040 (GRCh37)
                    Canonical SPDI:
                    NC_000006.12:131890899:G:A,NC_000006.12:131890899:G:T
                    Gene:
                    ENPP1 (Varview)
                    Functional Consequence:
                    3_prime_UTR_variant
                    Clinical significance:
                    benign
                    Validated:
                    by frequency,by alfa,by cluster
                    MAF:
                    A=0.09597/2891 (ALFA)
                    A=0.028795/129 (Estonian)
                    A=0.04/24 (NorthernSweden)
                    A=0.04509/45 (GoNL)
                    A=0.048813/181 (TWINSUK)
                    A=0.05/2 (GENOME_DK)
                    A=0.050078/193 (ALSPAC)
                    A=0.077601/88 (Daghestan)
                    A=0.109424/3430 (GnomAD)
                    A=0.116214/582 (1000Genomes)
                    A=0.123344/15488 (TOPMED)
                    A=0.157407/34 (Qatari)
                    A=0.18287/316 (HapMap)
                    G=0.328571/23 (SGDP_PRJ)
                    G=0.5/1 (Siberian)
                    HGVS:
                    10.

                    rs559 [Homo sapiens]
                      Variant type:
                      SNV
                      Alleles:
                      T>C [Show Flanks]
                      Chromosome:
                      21:46129655 (GRCh38)
                      21:47549569 (GRCh37)
                      Canonical SPDI:
                      NC_000021.9:46129654:T:C
                      Gene:
                      COL6A2 (Varview)
                      Functional Consequence:
                      non_coding_transcript_variant,3_prime_UTR_variant,intron_variant
                      Clinical significance:
                      benign
                      Validated:
                      by frequency,by alfa,by cluster
                      MAF:
                      C=0.060855/5364 (ALFA)
                      C=0.028333/17 (NorthernSweden)
                      C=0.036072/36 (GoNL)
                      C=0.040625/182 (Estonian)
                      C=0.044768/166 (TWINSUK)
                      C=0.04904/189 (ALSPAC)
                      C=0.05/2 (GENOME_DK)
                      C=0.12195/3818 (GnomAD)
                      C=0.134259/29 (Qatari)
                      C=0.142903/17944 (TOPMED)
                      C=0.199681/1000 (1000Genomes)
                      C=0.228571/432 (HapMap)
                      C=0.3125/65 (Vietnamese)
                      C=0.415208/759 (Korea1K)
                      C=0.434426/1272 (KOREAN)
                      T=0.442308/69 (SGDP_PRJ)
                      T=0.454545/10 (Siberian)
                      HGVS:
                      11.

                      rs567 [Homo sapiens]
                        Variant type:
                        SNV
                        Alleles:
                        G>A [Show Flanks]
                        Chromosome:
                        5:53683267 (GRCh38)
                        5:52979097 (GRCh37)
                        Canonical SPDI:
                        NC_000005.10:53683266:G:A
                        Gene:
                        NDUFS4 (Varview)
                        Functional Consequence:
                        non_coding_transcript_variant,genic_downstream_transcript_variant,3_prime_UTR_variant
                        Clinical significance:
                        likely-benign
                        Validated:
                        by frequency,by alfa,by cluster
                        MAF:
                        A=0.474112/68440 (ALFA)
                        A=0.293122/537 (Korea1K)
                        A=0.295563/866 (KOREAN)
                        A=0.3/12 (GENOME_DK)
                        A=0.324074/70 (Vietnamese)
                        G=0.328571/115 (SGDP_PRJ)
                        A=0.332975/620 (HapMap)
                        A=0.365741/79 (Qatari)
                        A=0.378594/1896 (1000Genomes)
                        A=0.379037/29414 (PAGE_STUDY)
                        A=0.388333/233 (NorthernSweden)
                        G=0.404762/17 (Siberian)
                        A=0.408177/51254 (TOPMED)
                        A=0.419499/5456 (GoESP)
                        A=0.420069/13149 (GnomAD)
                        A=0.448487/53491 (ExAC)
                        A=0.455912/455 (GoNL)
                        A=0.456542/113385 (GnomAD_exomes)
                        A=0.479502/1848 (ALSPAC)
                        A=0.479687/2149 (Estonian)
                        A=0.487325/1807 (TWINSUK)
                        A=0.488764/261 (MGP)
                        HGVS:
                        12.

                        rs576 [Homo sapiens]
                          Variant type:
                          SNV
                          Alleles:
                          C>G,T [Show Flanks]
                          Chromosome:
                          3:69967316 (GRCh38)
                          3:70016467 (GRCh37)
                          Canonical SPDI:
                          NC_000003.12:69967315:C:G,NC_000003.12:69967315:C:T
                          Gene:
                          MITF (Varview)
                          Functional Consequence:
                          3_prime_UTR_variant,genic_downstream_transcript_variant
                          Clinical significance:
                          benign
                          Validated:
                          by frequency,by alfa,by cluster
                          MAF:
                          T=0.293965/25368 (ALFA)
                          T=0.225/9 (GENOME_DK)
                          T=0.230337/123 (MGP)
                          T=0.245283/52 (Vietnamese)
                          T=0.249499/249 (GoNL)
                          T=0.259259/56 (Qatari)
                          T=0.278857/1034 (TWINSUK)
                          T=0.291386/1123 (ALSPAC)
                          T=0.325/1456 (Estonian)
                          T=0.326667/196 (NorthernSweden)
                          T=0.336837/42296 (TOPMED)
                          T=0.336879/10545 (GnomAD)
                          T=0.341054/1708 (1000Genomes)
                          T=0.345524/633 (Korea1K)
                          T=0.35148/665 (HapMap)
                          T=0.351536/1030 (KOREAN)
                          C=0.368421/14 (Siberian)
                          C=0.393855/141 (SGDP_PRJ)
                          HGVS:
                          NC_000003.12:g.69967316C>G, NC_000003.12:g.69967316C>T, NC_000003.11:g.70016467C>G, NC_000003.11:g.70016467C>T, NG_011631.1:g.232835C>G, NG_011631.1:g.232835C>T, NM_000248.4:c.*2068C>G, NM_000248.4:c.*2068C>T, NM_000248.3:c.*2068C>G, NM_000248.3:c.*2068C>T, NM_198159.3:c.*2068C>G, NM_198159.3:c.*2068C>T, NM_198159.2:c.*2068C>G, NM_198159.2:c.*2068C>T, NM_198177.3:c.*2068C>G, NM_198177.3:c.*2068C>T, NM_198177.2:c.*2068C>G, NM_198177.2:c.*2068C>T, NM_198158.3:c.*2068C>G, NM_198158.3:c.*2068C>T, NM_198158.2:c.*2068C>G, NM_198158.2:c.*2068C>T, NM_198178.3:c.*2068C>G, NM_198178.3:c.*2068C>T, NM_198178.2:c.*2068C>G, NM_198178.2:c.*2068C>T, NM_001354607.2:c.*2068C>G, NM_001354607.2:c.*2068C>T, NM_001354607.1:c.*2068C>G, NM_001354607.1:c.*2068C>T, NM_001354608.2:c.*2068C>G, NM_001354608.2:c.*2068C>T, NM_001354608.1:c.*2068C>G, NM_001354608.1:c.*2068C>T, NM_001354604.2:c.*2068C>G, NM_001354604.2:c.*2068C>T, NM_001354604.1:c.*2068C>G, NM_001354604.1:c.*2068C>T, NM_001354605.2:c.*2068C>G, NM_001354605.2:c.*2068C>T, NM_001354605.1:c.*2068C>G, NM_001354605.1:c.*2068C>T, NM_001354606.2:c.*2068C>G, NM_001354606.2:c.*2068C>T, NM_001354606.1:c.*2068C>G, NM_001354606.1:c.*2068C>T, NM_001184967.2:c.*2068C>G, NM_001184967.2:c.*2068C>T, NM_001184967.1:c.*2068C>G, NM_001184967.1:c.*2068C>T, NM_006722.2:c.*2068C>G, NM_006722.2:c.*2068C>T
                          13.

                          rs662 [Homo sapiens]
                            Variant type:
                            SNV
                            Alleles:
                            T>A,C,G [Show Flanks]
                            Chromosome:
                            7:95308134 (GRCh38)
                            7:94937446 (GRCh37)
                            Canonical SPDI:
                            NC_000007.14:95308133:T:A,NC_000007.14:95308133:T:C,NC_000007.14:95308133:T:G
                            Gene:
                            PON1 (Varview)
                            Functional Consequence:
                            missense_variant,coding_sequence_variant
                            Clinical significance:
                            association,risk-factor
                            Validated:
                            by frequency,by alfa,by cluster
                            MAF:
                            C=0.310388/56742 (ALFA)
                            G=0./0 (KOREAN)
                            C=0.247991/1111 (Estonian)
                            C=0.253333/152 (NorthernSweden)
                            T=0.2675/107 (SGDP_PRJ)
                            C=0.276316/84 (FINRISK)
                            C=0.278857/1034 (TWINSUK)
                            C=0.283567/283 (GoNL)
                            C=0.290348/1119 (ALSPAC)
                            T=0.294788/181 (Vietnamese)
                            C=0.3/12 (GENOME_DK)
                            C=0.301431/337 (Daghestan)
                            C=0.307116/164 (MGP)
                            T=0.347826/16 (Siberian)
                            C=0.377047/45735 (ExAC)
                            C=0.378433/95101 (GnomAD_exomes)
                            C=0.37963/82 (Qatari)
                            C=0.407194/12746 (GnomAD)
                            T=0.42789/807 (HapMap)
                            T=0.428751/33741 (PAGE_STUDY)
                            C=0.439411/55176 (TOPMED)
                            T=0.457069/2289 (1000Genomes)
                            C=0.491363/1024 (HGDP_Stanford)
                            T=0.491525/174 (PharmGKB)
                            HGVS:
                            14.

                            rs669 [Homo sapiens]
                              Variant type:
                              SNV
                              Alleles:
                              T>C [Show Flanks]
                              Chromosome:
                              12:9079672 (GRCh38)
                              12:9232268 (GRCh37)
                              Canonical SPDI:
                              NC_000012.12:9079671:T:C
                              Gene:
                              A2M (Varview), KLRG1 (Varview)
                              Functional Consequence:
                              genic_downstream_transcript_variant,coding_sequence_variant,intron_variant,missense_variant
                              Clinical significance:
                              benign,risk-factor
                              Validated:
                              by frequency,by alfa,by cluster
                              MAF:
                              C=0.33296/62137 (ALFA)
                              C=0.075085/220 (KOREAN)
                              C=0.096248/59 (Vietnamese)
                              C=0.185185/40 (Qatari)
                              C=0.243386/276 (Daghestan)
                              C=0.246398/513 (HGDP_Stanford)
                              C=0.246554/465 (HapMap)
                              C=0.254393/1274 (1000Genomes)
                              C=0.280363/22064 (PAGE_STUDY)
                              C=0.301498/161 (MGP)
                              C=0.309537/38868 (TOPMED)
                              C=0.309818/77045 (GnomAD_exomes)
                              C=0.310214/37096 (ExAC)
                              C=0.337379/1251 (TWINSUK)
                              C=0.337675/337 (GoNL)
                              C=0.338458/10612 (GnomAD)
                              C=0.344837/1329 (ALSPAC)
                              C=0.365/219 (NorthernSweden)
                              T=0.365/73 (SGDP_PRJ)
                              C=0.375/15 (GENOME_DK)
                              C=0.405134/1815 (Estonian)
                              C=0.424342/129 (FINRISK)
                              T=0.428571/12 (Siberian)
                              HGVS:
                              15.

                              rs671 [Homo sapiens]
                                Variant type:
                                SNV
                                Alleles:
                                G>A [Show Flanks]
                                Chromosome:
                                12:111803962 (GRCh38)
                                12:112241766 (GRCh37)
                                Canonical SPDI:
                                NC_000012.12:111803961:G:A
                                Gene:
                                ALDH2 (Varview)
                                Functional Consequence:
                                coding_sequence_variant,missense_variant
                                Clinical significance:
                                drug-response,protective,risk-factor
                                Validated:
                                by frequency,by alfa,by cluster
                                MAF:
                                A=0.000873/122 (ALFA)
                                A=0./0 (TWINSUK)
                                A=0.001038/4 (ALSPAC)
                                A=0.005396/6 (Daghestan)
                                A=0.013398/420 (GnomAD)
                                A=0.015609/1960 (TOPMED)
                                A=0.018882/4582 (GnomAD_exomes)
                                A=0.021287/1878 (ExAC)
                                A=0.027166/2138 (PAGE_STUDY)
                                A=0.035743/179 (1000Genomes)
                                A=0.129921/99 (HapMap)
                                A=0.155568/285 (Korea1K)
                                A=0.172591/505 (KOREAN)
                                A=0.208609/126 (Vietnamese)
                                G=0.5/11 (SGDP_PRJ)
                                HGVS:
                                16.

                                rs674 [Homo sapiens]
                                  Variant type:
                                  SNV
                                  Alleles:
                                  G>A [Show Flanks]
                                  Chromosome:
                                  12:64716361 (GRCh38)
                                  12:65110141 (GRCh37)
                                  Canonical SPDI:
                                  NC_000012.12:64716360:G:A
                                  Gene:
                                  GNS (Varview)
                                  Functional Consequence:
                                  3_prime_UTR_variant
                                  Clinical significance:
                                  benign
                                  Validated:
                                  by frequency,by alfa,by cluster
                                  MAF:
                                  G=0.407415/7912 (ALFA)
                                  G=0.117925/25 (Vietnamese)
                                  G=0.129352/379 (KOREAN)
                                  G=0.173913/8 (Siberian)
                                  G=0.204082/100 (SGDP_PRJ)
                                  G=0.284345/1424 (1000Genomes)
                                  G=0.307453/99 (HapMap)
                                  G=0.35/14 (GENOME_DK)
                                  G=0.35281/11062 (GnomAD)
                                  G=0.36405/45713 (TOPMED)
                                  G=0.370089/1658 (Estonian)
                                  G=0.405/243 (NorthernSweden)
                                  G=0.406072/1565 (ALSPAC)
                                  G=0.410822/410 (GoNL)
                                  G=0.413161/1532 (TWINSUK)
                                  G=0.421296/91 (Qatari)
                                  HGVS:
                                  17.

                                  rs678 [Homo sapiens]
                                    Variant type:
                                    SNV
                                    Alleles:
                                    A>C,G,T [Show Flanks]
                                    Chromosome:
                                    3:52786965 (GRCh38)
                                    3:52820981 (GRCh37)
                                    Canonical SPDI:
                                    NC_000003.12:52786964:A:C,NC_000003.12:52786964:A:G,NC_000003.12:52786964:A:T
                                    Gene:
                                    ITIH1 (Varview)
                                    Functional Consequence:
                                    coding_sequence_variant,missense_variant
                                    Clinical significance:
                                    benign
                                    Validated:
                                    by frequency,by alfa,by cluster
                                    MAF:
                                    T=0.376615/5479 (ALFA)
                                    G=0./0 (KOREAN)
                                    T=0.183601/103 (Vietnamese)
                                    T=0.27439/90 (HapMap)
                                    T=0.286941/1437 (1000Genomes)
                                    T=0.3004/3907 (GoESP)
                                    T=0.309051/9643 (GnomAD)
                                    T=0.314825/39532 (TOPMED)
                                    T=0.325/13 (GENOME_DK)
                                    T=0.327715/175 (MGP)
                                    T=0.350054/1298 (TWINSUK)
                                    T=0.352233/42268 (ExAC)
                                    T=0.354956/1368 (ALSPAC)
                                    T=0.355/213 (NorthernSweden)
                                    T=0.357867/89532 (GnomAD_exomes)
                                    T=0.371743/371 (GoNL)
                                    A=0.38255/114 (SGDP_PRJ)
                                    A=0.384615/10 (Siberian)
                                    T=0.391246/1752 (Estonian)
                                    T=0.444444/96 (Qatari)
                                    T=0.446667/134 (FINRISK)
                                    HGVS:
                                    NC_000003.12:g.52786965A>C, NC_000003.12:g.52786965A>G, NC_000003.12:g.52786965A>T, NC_000003.11:g.52820981A>C, NC_000003.11:g.52820981A>G, NC_000003.11:g.52820981A>T, NG_016005.1:g.14374A>C, NG_016005.1:g.14374A>G, NG_016005.1:g.14374A>T, NM_002215.4:c.1754A>C, NM_002215.4:c.1754A>G, NM_002215.4:c.1754A>T, NM_002215.3:c.1754A>C, NM_002215.3:c.1754A>G, NM_002215.3:c.1754A>T, NM_001166434.3:c.1328A>C, NM_001166434.3:c.1328A>G, NM_001166434.3:c.1328A>T, NM_001166434.2:c.1328A>C, NM_001166434.2:c.1328A>G, NM_001166434.2:c.1328A>T, NM_001166435.2:c.890A>C, NM_001166435.2:c.890A>G, NM_001166435.2:c.890A>T, NM_001166436.2:c.890A>C, NM_001166436.2:c.890A>G, NM_001166436.2:c.890A>T, NP_002206.2:p.Glu585Ala, NP_002206.2:p.Glu585Gly, NP_002206.2:p.Glu585Val, NP_001159906.1:p.Glu443Ala, NP_001159906.1:p.Glu443Gly, NP_001159906.1:p.Glu443Val, NP_001159907.1:p.Glu297Ala, NP_001159907.1:p.Glu297Gly, NP_001159907.1:p.Glu297Val, NP_001159908.1:p.Glu297Ala, NP_001159908.1:p.Glu297Gly, NP_001159908.1:p.Glu297Val
                                    18.

                                    rs683 [Homo sapiens]
                                      Variant type:
                                      SNV
                                      Alleles:
                                      C>A [Show Flanks]
                                      Chromosome:
                                      9:12709305 (GRCh38)
                                      9:12709305 (GRCh37)
                                      Canonical SPDI:
                                      NC_000009.12:12709304:C:A
                                      Gene:
                                      TYRP1 (Varview), LURAP1L-AS1 (Varview)
                                      Functional Consequence:
                                      3_prime_UTR_variant,intron_variant,non_coding_transcript_variant
                                      Clinical significance:
                                      benign
                                      Validated:
                                      by frequency,by alfa,by cluster
                                      MAF:
                                      C=0.389295/55311 (ALFA)
                                      A=0.004107/12 (KOREAN)
                                      A=0.018692/4 (Vietnamese)
                                      A=0.251997/1262 (1000Genomes)
                                      C=0.255/153 (NorthernSweden)
                                      A=0.269345/21191 (PAGE_STUDY)
                                      A=0.276657/576 (HGDP_Stanford)
                                      A=0.277778/60 (Qatari)
                                      A=0.281285/508 (HapMap)
                                      C=0.302455/1355 (Estonian)
                                      C=0.324649/324 (GoNL)
                                      C=0.326861/1212 (TWINSUK)
                                      C=0.333333/14 (Siberian)
                                      C=0.349507/1347 (ALSPAC)
                                      C=0.35/14 (GENOME_DK)
                                      C=0.350877/80 (SGDP_PRJ)
                                      A=0.374532/200 (MGP)
                                      A=0.441848/55482 (TOPMED)
                                      A=0.497829/15592 (GnomAD)
                                      HGVS:
                                      19.

                                      rs684 [Homo sapiens]
                                        Variant type:
                                        SNV
                                        Alleles:
                                        C>T [Show Flanks]
                                        Chromosome:
                                        21:44886246 (GRCh38)
                                        21:46306161 (GRCh37)
                                        Canonical SPDI:
                                        NC_000021.9:44886245:C:T
                                        Gene:
                                        ITGB2 (Varview)
                                        Functional Consequence:
                                        3_prime_UTR_variant
                                        Clinical significance:
                                        likely-benign
                                        Validated:
                                        by frequency,by alfa,by cluster
                                        MAF:
                                        T=0.222863/11280 (ALFA)
                                        T=0.051887/11 (Vietnamese)
                                        T=0.069288/37 (MGP)
                                        T=0.098294/288 (KOREAN)
                                        T=0.101528/186 (Korea1K)
                                        T=0.158347/793 (1000Genomes)
                                        T=0.15873/300 (HapMap)
                                        T=0.170029/354 (HGDP_Stanford)
                                        T=0.186901/117 (Chileans)
                                        T=0.190574/5960 (GnomAD)
                                        T=0.1918/24084 (TOPMED)
                                        T=0.213025/821 (ALSPAC)
                                        T=0.213333/128 (NorthernSweden)
                                        T=0.223571/829 (TWINSUK)
                                        T=0.225/9 (GENOME_DK)
                                        T=0.225451/225 (GoNL)
                                        T=0.231696/1038 (Estonian)
                                        T=0.263889/57 (Qatari)
                                        C=0.45/72 (SGDP_PRJ)
                                        C=0.5/4 (Siberian)
                                        HGVS:
                                        20.

                                        rs688 [Homo sapiens]
                                          Variant type:
                                          SNV
                                          Alleles:
                                          C>T [Show Flanks]
                                          Chromosome:
                                          19:11116926 (GRCh38)
                                          19:11227602 (GRCh37)
                                          Canonical SPDI:
                                          NC_000019.10:11116925:C:T
                                          Gene:
                                          LDLR (Varview)
                                          Functional Consequence:
                                          synonymous_variant,intron_variant,non_coding_transcript_variant,coding_sequence_variant
                                          Clinical significance:
                                          benign,benign-likely-benign
                                          Validated:
                                          by frequency,by alfa,by cluster
                                          MAF:
                                          T=0.417679/62778 (ALFA)
                                          T=0.144178/421 (KOREAN)
                                          T=0.211945/401 (HapMap)
                                          T=0.212662/131 (Vietnamese)
                                          T=0.275759/1381 (1000Genomes)
                                          T=0.289347/603 (HGDP_Stanford)
                                          T=0.316554/39749 (TOPMED)
                                          T=0.328913/10293 (GnomAD)
                                          C=0.333333/6 (Siberian)
                                          T=0.33523/4360 (GoESP)
                                          C=0.347656/89 (SGDP_PRJ)
                                          T=0.353333/212 (NorthernSweden)
                                          T=0.375/15 (GENOME_DK)
                                          T=0.378118/45902 (ExAC)
                                          T=0.389173/97866 (GnomAD_exomes)
                                          T=0.400749/214 (MGP)
                                          T=0.403795/1809 (Estonian)
                                          T=0.4375/133 (FINRISK)
                                          T=0.444714/1649 (TWINSUK)
                                          T=0.452257/1743 (ALSPAC)
                                          T=0.452906/452 (GoNL)
                                          T=0.467593/101 (Qatari)
                                          T=0.495208/310 (Chileans)
                                          HGVS:

                                          Display Settings:

                                          Format
                                          Items per page
                                          Sort by

                                          Send to:

                                          Choose Destination

                                          Supplemental Content

                                          Find related data

                                          Search details

                                          See more...

                                          Recent activity

                                          Support Center