Skip to main page content
Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation

dbSNP Short Genetic Variations

Welcome to the Reference SNP (rs) Report

All alleles are reported in the Forward orientation. Click on the Variant Details tab for details on Genomic Placement, Gene, and Amino Acid changes. HGVS names are in the HGVS tab.

Reference SNP (rs) Report

This page reports data for a single dbSNP Reference SNP variation (RefSNP or rs) from the new redesigned dbSNP build.
Top of the page reports a concise summary for the rs, with more specific details included in the corresponding tabs below.
All alleles are reported in the Forward orientation. Use the Genomic View to inspect the nucleotides flanking the variant, and its neighbors.
For more information see Help documentation.

rs1011000296

Current Build 155

Released April 9, 2021

Organism
Homo sapiens
Position
chr10:253834-253850 (GRCh38.p13) Help

The anchor position for this RefSNP. Includes all nucleotides potentially affected by this change, thus it can differ from HGVS, which is right-shifted. See here for details.

Alleles
dupCC(T)4(A)5G
Variation Type
Indel Insertion and Deletion
Frequency
dupCC(T)4(A)5G=0.000045 (12/264690, TOPMED)
dupCC(T)4(A)5G=0.000036 (5/140210, GnomAD)
dupCC(T)4(A)5G=0.00007 (1/14050, ALFA)
Clinical Significance
Not Reported in ClinVar
Gene : Consequence
ZMYND11 : Non Coding Transcript Variant
Publications
0 citations
Genomic View
See rs on genome
Help

Variant Details tab shows known variant placements on genomic sequences: chromosomes (NC_), RefSeqGene, pseudogenes or genomic regions (NG_), and in a separate table: on transcripts (NM_) and protein sequences (NP_). The corresponding transcript and protein locations are listed in adjacent lines, along with molecular consequences from Sequence Ontology. When no protein placement is available, only the transcript is listed. Column "Codon[Amino acid]" shows the actual base change in the format of "Reference > Alternate" allele, including the nucleotide codon change in transcripts, and the amino acid change in proteins, respectively, allowing for known ribosomal slippage sites. To view nucleotides adjacent to the variant use the Genomic View at the bottom of the page - zoom into the sequence until the nucleotides around the variant become visible.

Genomic Placements
Sequence name Change
GRCh38.p13 chr 10 NC_000010.11:g.253839_253850dup
GRCh37.p13 chr 10 NC_000010.10:g.299779_299790dup
ZMYND11 RefSeqGene NG_029960.1:g.124375_124386dup
Gene: ZMYND11, zinc finger MYND-type containing 11 (plus strand)
Molecule type Change Amino acid[Codon] SO Term
ZMYND11 transcript variant 6 NM_001202466.3:c.*1364_*1…

NM_001202466.3:c.*1364_*1380=

N/A 3 Prime UTR Variant
ZMYND11 transcript variant 23 NM_001370110.2:c.*1364_*1…

NM_001370110.2:c.*1364_*1380=

N/A 3 Prime UTR Variant
ZMYND11 transcript variant 19 NM_001370106.2:c.*1364_*1…

NM_001370106.2:c.*1364_*1380=

N/A 3 Prime UTR Variant
ZMYND11 transcript variant 4 NM_001202464.3:c.*1364_*1…

NM_001202464.3:c.*1364_*1380=

N/A 3 Prime UTR Variant
ZMYND11 transcript variant 27 NM_001370114.2:c.*1364_*1…

NM_001370114.2:c.*1364_*1380=

N/A 3 Prime UTR Variant
ZMYND11 transcript variant 25 NM_001370112.2:c.*1364_*1…

NM_001370112.2:c.*1364_*1380=

N/A 3 Prime UTR Variant
ZMYND11 transcript variant 35 NM_001370122.2:c.*1364_*1…

NM_001370122.2:c.*1364_*1380=

N/A 3 Prime UTR Variant
ZMYND11 transcript variant 14 NM_001370101.2:c.*1364_*1…

NM_001370101.2:c.*1364_*1380=

N/A 3 Prime UTR Variant
ZMYND11 transcript variant 15 NM_001370102.2:c.*1364_*1…

NM_001370102.2:c.*1364_*1380=

N/A 3 Prime UTR Variant
ZMYND11 transcript variant 24 NM_001370111.2:c.*1364_*1…

NM_001370111.2:c.*1364_*1380=

N/A 3 Prime UTR Variant
ZMYND11 transcript variant 21 NM_001370108.2:c.*1364_*1…

NM_001370108.2:c.*1364_*1380=

N/A 3 Prime UTR Variant
ZMYND11 transcript variant 33 NM_001370120.2:c.*1364_*1…

NM_001370120.2:c.*1364_*1380=

N/A 3 Prime UTR Variant
ZMYND11 transcript variant 11 NM_001370098.2:c.*1364_*1…

NM_001370098.2:c.*1364_*1380=

N/A 3 Prime UTR Variant
ZMYND11 transcript variant 16 NM_001370103.2:c.*1364_*1…

NM_001370103.2:c.*1364_*1380=

N/A 3 Prime UTR Variant
ZMYND11 transcript variant 26 NM_001370113.2:c.*1364_*1…

NM_001370113.2:c.*1364_*1380=

N/A 3 Prime UTR Variant
ZMYND11 transcript variant 10 NM_001370097.3:c.*1364_*1…

NM_001370097.3:c.*1364_*1380=

N/A 3 Prime UTR Variant
ZMYND11 transcript variant 37 NM_001370124.3:c.*1364_*1…

NM_001370124.3:c.*1364_*1380=

N/A 3 Prime UTR Variant
ZMYND11 transcript variant 36 NM_001370123.2:c.*1364_*1…

NM_001370123.2:c.*1364_*1380=

N/A 3 Prime UTR Variant
ZMYND11 transcript variant 12 NM_001370099.2:c.*1364_*1…

NM_001370099.2:c.*1364_*1380=

N/A 3 Prime UTR Variant
ZMYND11 transcript variant 5 NM_001202465.3:c.*1364_*1…

NM_001202465.3:c.*1364_*1380=

N/A 3 Prime UTR Variant
ZMYND11 transcript variant 28 NM_001370115.2:c.*1364_*1…

NM_001370115.2:c.*1364_*1380=

N/A 3 Prime UTR Variant
ZMYND11 transcript variant 17 NM_001370104.2:c.*1364_*1…

NM_001370104.2:c.*1364_*1380=

N/A 3 Prime UTR Variant
ZMYND11 transcript variant 22 NM_001370109.2:c.*1364_*1…

NM_001370109.2:c.*1364_*1380=

N/A 3 Prime UTR Variant
ZMYND11 transcript variant 31 NM_001370118.2:c.*1364_*1…

NM_001370118.2:c.*1364_*1380=

N/A 3 Prime UTR Variant
ZMYND11 transcript variant 34 NM_001370121.2:c.*1364_*1…

NM_001370121.2:c.*1364_*1380=

N/A 3 Prime UTR Variant
ZMYND11 transcript variant 29 NM_001370116.2:c.*1364_*1…

NM_001370116.2:c.*1364_*1380=

N/A 3 Prime UTR Variant
ZMYND11 transcript variant 18 NM_001370105.2:c.*1364_*1…

NM_001370105.2:c.*1364_*1380=

N/A 3 Prime UTR Variant
ZMYND11 transcript variant 32 NM_001370119.2:c.*1364_*1…

NM_001370119.2:c.*1364_*1380=

N/A 3 Prime UTR Variant
ZMYND11 transcript variant 1 NM_006624.7:c.*1364_*1380= N/A 3 Prime UTR Variant
ZMYND11 transcript variant 30 NM_001370117.2:c.*1364_*1…

NM_001370117.2:c.*1364_*1380=

N/A 3 Prime UTR Variant
ZMYND11 transcript variant 20 NM_001370107.2:c.*1364_*1…

NM_001370107.2:c.*1364_*1380=

N/A 3 Prime UTR Variant
ZMYND11 transcript variant 9 NM_001330057.3:c.*1364_*1…

NM_001330057.3:c.*1364_*1380=

N/A 3 Prime UTR Variant
ZMYND11 transcript variant 13 NM_001370100.5:c.*1364_*1…

NM_001370100.5:c.*1364_*1380=

N/A 3 Prime UTR Variant
ZMYND11 transcript variant 7 NM_001202467.1:c. N/A Genic Downstream Transcript Variant
ZMYND11 transcript variant 8 NM_001202468.1:c. N/A Genic Downstream Transcript Variant
ZMYND11 transcript variant 2 NM_212479.4:c. N/A Genic Downstream Transcript Variant
ZMYND11 transcript variant 38 NR_163254.2:n.3209_3220dup N/A Non Coding Transcript Variant
ZMYND11 transcript variant X12 XM_017015594.1:c.*1364_*1…

XM_017015594.1:c.*1364_*1380=

N/A 3 Prime UTR Variant
Help

Clinical Significance tab shows a list of clinical significance entries from ClinVar associated with the variation, per allele. Click on the RCV accession (i.e. RCV000001615.2) or Allele ID (i.e. 12274) to access full ClinVar report.

Not Reported in ClinVar

ALFA Allele Frequency (New)
The ALFA project provide aggregate allele frequency from dbGaP. More information is available on the project page including descriptions, data access, and terms of use.

Release Version: 20201027095038
Population Group Sample Size Ref Allele Alt Allele
Total Global 14050 AAAAGCCTTTTAAAAAG=0.99993 AAAAGCCTTTTAAAAAGCCTTTTAAAAAG=0.00007
European Sub 9690 AAAAGCCTTTTAAAAAG=0.9999 AAAAGCCTTTTAAAAAGCCTTTTAAAAAG=0.0001
African Sub 2898 AAAAGCCTTTTAAAAAG=1.0000 AAAAGCCTTTTAAAAAGCCTTTTAAAAAG=0.0000
African Others Sub 114 AAAAGCCTTTTAAAAAG=1.000 AAAAGCCTTTTAAAAAGCCTTTTAAAAAG=0.000
African American Sub 2784 AAAAGCCTTTTAAAAAG=1.0000 AAAAGCCTTTTAAAAAGCCTTTTAAAAAG=0.0000
Asian Sub 112 AAAAGCCTTTTAAAAAG=1.000 AAAAGCCTTTTAAAAAGCCTTTTAAAAAG=0.000
East Asian Sub 86 AAAAGCCTTTTAAAAAG=1.00 AAAAGCCTTTTAAAAAGCCTTTTAAAAAG=0.00
Other Asian Sub 26 AAAAGCCTTTTAAAAAG=1.00 AAAAGCCTTTTAAAAAGCCTTTTAAAAAG=0.00
Latin American 1 Sub 146 AAAAGCCTTTTAAAAAG=1.000 AAAAGCCTTTTAAAAAGCCTTTTAAAAAG=0.000
Latin American 2 Sub 610 AAAAGCCTTTTAAAAAG=1.000 AAAAGCCTTTTAAAAAGCCTTTTAAAAAG=0.000
South Asian Sub 98 AAAAGCCTTTTAAAAAG=1.00 AAAAGCCTTTTAAAAAGCCTTTTAAAAAG=0.00
Other Sub 496 AAAAGCCTTTTAAAAAG=1.000 AAAAGCCTTTTAAAAAGCCTTTTAAAAAG=0.000


Help

Frequency tab displays a table of the reference and alternate allele frequencies reported by various studies and populations. Table lines, where Population="Global" refer to the entire study population, whereas lines, where Group="Sub", refer to a study-specific population subgroupings (i.e. AFR, CAU, etc.), if available. Frequency for the alternate allele (Alt Allele) is a ratio of samples observed-to-total, where the numerator (observed samples) is the number of chromosomes in the study with the minor allele present (found in "Sample size", where Group="Sub"), and the denominator (total samples) is the total number of all chromosomes in the study for the variant (found in "Sample size", where Group="Study-wide" and Population="Global").

Download
Study Population Group Sample Size Ref Allele Alt Allele
TopMed Global Study-wide 264690 -

No frequency provided

dupCC(T)4(A)5G=0.000045
gnomAD - Genomes Global Study-wide 140210 -

No frequency provided

dupCC(T)4(A)5G=0.000036
gnomAD - Genomes European Sub 75936 -

No frequency provided

dupCC(T)4(A)5G=0.00004
gnomAD - Genomes African Sub 42008 -

No frequency provided

dupCC(T)4(A)5G=0.00005
gnomAD - Genomes American Sub 13662 -

No frequency provided

dupCC(T)4(A)5G=0.00000
gnomAD - Genomes Ashkenazi Jewish Sub 3324 -

No frequency provided

dupCC(T)4(A)5G=0.0000
gnomAD - Genomes East Asian Sub 3128 -

No frequency provided

dupCC(T)4(A)5G=0.0000
gnomAD - Genomes Other Sub 2152 -

No frequency provided

dupCC(T)4(A)5G=0.0000
Allele Frequency Aggregator Total Global 14050 (A)4GCC(T)4(A)5G=0.99993 dupCC(T)4(A)5G=0.00007
Allele Frequency Aggregator European Sub 9690 (A)4GCC(T)4(A)5G=0.9999 dupCC(T)4(A)5G=0.0001
Allele Frequency Aggregator African Sub 2898 (A)4GCC(T)4(A)5G=1.0000 dupCC(T)4(A)5G=0.0000
Allele Frequency Aggregator Latin American 2 Sub 610 (A)4GCC(T)4(A)5G=1.000 dupCC(T)4(A)5G=0.000
Allele Frequency Aggregator Other Sub 496 (A)4GCC(T)4(A)5G=1.000 dupCC(T)4(A)5G=0.000
Allele Frequency Aggregator Latin American 1 Sub 146 (A)4GCC(T)4(A)5G=1.000 dupCC(T)4(A)5G=0.000
Allele Frequency Aggregator Asian Sub 112 (A)4GCC(T)4(A)5G=1.000 dupCC(T)4(A)5G=0.000
Allele Frequency Aggregator South Asian Sub 98 (A)4GCC(T)4(A)5G=1.00 dupCC(T)4(A)5G=0.00
Help

Aliases tab displays HGVS names representing the variant placements and allele changes on genomic, transcript and protein sequences, per allele. HGVS name is an expression for reporting sequence accession and version, sequence type, position, and allele change. The column "Note" can have two values: "diff" means that there is a difference between the reference allele (variation interval) at the placement reported in HGVS name and the reference alleles reported in other HGVS names, and "rev" means that the sequence of this variation interval at the placement reported in HGVS name is in reverse orientation to the sequence(s) of this variation in other HGVS names not labeled as "rev".

Placement (A)4GCC(T)4(A)5G= dupCC(T)4(A)5G
GRCh38.p13 chr 10 NC_000010.11:g.253834_253850= NC_000010.11:g.253839_253850dup
GRCh37.p13 chr 10 NC_000010.10:g.299774_299790= NC_000010.10:g.299779_299790dup
ZMYND11 RefSeqGene NG_029960.1:g.124370_124386= NG_029960.1:g.124375_124386dup
ZMYND11 transcript variant 1 NM_006624.7:c.*1364_*1380= NM_006624.7:c.*1369_*1380dup
ZMYND11 transcript variant 1 NM_006624.6:c.*1364_*1380= NM_006624.6:c.*1369_*1380dup
ZMYND11 transcript variant 1 NM_006624.5:c.*1364_*1380= NM_006624.5:c.*1369_*1380dup
ZMYND11 transcript variant 13 NM_001370100.5:c.*1364_*1380= NM_001370100.5:c.*1369_*1380dup
ZMYND11 transcript variant 13 NM_001370100.4:c.*1364_*1380= NM_001370100.4:c.*1369_*1380dup
ZMYND11 transcript variant 13 NM_001370100.3:c.*1364_*1380= NM_001370100.3:c.*1369_*1380dup
ZMYND11 transcript variant 13 NM_001370100.2:c.*1364_*1380= NM_001370100.2:c.*1369_*1380dup
ZMYND11 transcript variant 13 NM_001370100.1:c.*1364_*1380= NM_001370100.1:c.*1369_*1380dup
ZMYND11 transcript variant 9 NM_001330057.3:c.*1364_*1380= NM_001330057.3:c.*1369_*1380dup
ZMYND11 transcript variant 9 NM_001330057.2:c.*1364_*1380= NM_001330057.2:c.*1369_*1380dup
ZMYND11 transcript variant 9 NM_001330057.1:c.*1364_*1380= NM_001330057.1:c.*1369_*1380dup
ZMYND11 transcript variant 10 NM_001370097.3:c.*1364_*1380= NM_001370097.3:c.*1369_*1380dup
ZMYND11 transcript variant 10 NM_001370097.2:c.*1364_*1380= NM_001370097.2:c.*1369_*1380dup
ZMYND11 transcript variant 10 NM_001370097.1:c.*1364_*1380= NM_001370097.1:c.*1369_*1380dup
ZMYND11 transcript variant 6 NM_001202466.3:c.*1364_*1380= NM_001202466.3:c.*1369_*1380dup
ZMYND11 transcript variant 6 NM_001202466.2:c.*1364_*1380= NM_001202466.2:c.*1369_*1380dup
ZMYND11 transcript variant 6 NM_001202466.1:c.*1364_*1380= NM_001202466.1:c.*1369_*1380dup
ZMYND11 transcript variant 4 NM_001202464.3:c.*1364_*1380= NM_001202464.3:c.*1369_*1380dup
ZMYND11 transcript variant 4 NM_001202464.2:c.*1364_*1380= NM_001202464.2:c.*1369_*1380dup
ZMYND11 transcript variant 4 NM_001202464.1:c.*1364_*1380= NM_001202464.1:c.*1369_*1380dup
ZMYND11 transcript variant 5 NM_001202465.3:c.*1364_*1380= NM_001202465.3:c.*1369_*1380dup
ZMYND11 transcript variant 5 NM_001202465.2:c.*1364_*1380= NM_001202465.2:c.*1369_*1380dup
ZMYND11 transcript variant 5 NM_001202465.1:c.*1364_*1380= NM_001202465.1:c.*1369_*1380dup
ZMYND11 transcript variant 37 NM_001370124.3:c.*1364_*1380= NM_001370124.3:c.*1369_*1380dup
ZMYND11 transcript variant 37 NM_001370124.2:c.*1364_*1380= NM_001370124.2:c.*1369_*1380dup
ZMYND11 transcript variant 37 NM_001370124.1:c.*1364_*1380= NM_001370124.1:c.*1369_*1380dup
ZMYND11 transcript variant 15 NM_001370102.2:c.*1364_*1380= NM_001370102.2:c.*1369_*1380dup
ZMYND11 transcript variant 15 NM_001370102.1:c.*1364_*1380= NM_001370102.1:c.*1369_*1380dup
ZMYND11 transcript variant 22 NM_001370109.2:c.*1364_*1380= NM_001370109.2:c.*1369_*1380dup
ZMYND11 transcript variant 22 NM_001370109.1:c.*1364_*1380= NM_001370109.1:c.*1369_*1380dup
ZMYND11 transcript variant 11 NM_001370098.2:c.*1364_*1380= NM_001370098.2:c.*1369_*1380dup
ZMYND11 transcript variant 11 NM_001370098.1:c.*1364_*1380= NM_001370098.1:c.*1369_*1380dup
ZMYND11 transcript variant 26 NM_001370113.2:c.*1364_*1380= NM_001370113.2:c.*1369_*1380dup
ZMYND11 transcript variant 26 NM_001370113.1:c.*1364_*1380= NM_001370113.1:c.*1369_*1380dup
ZMYND11 transcript variant 20 NM_001370107.2:c.*1364_*1380= NM_001370107.2:c.*1369_*1380dup
ZMYND11 transcript variant 20 NM_001370107.1:c.*1364_*1380= NM_001370107.1:c.*1369_*1380dup
ZMYND11 transcript variant 31 NM_001370118.2:c.*1364_*1380= NM_001370118.2:c.*1369_*1380dup
ZMYND11 transcript variant 31 NM_001370118.1:c.*1364_*1380= NM_001370118.1:c.*1369_*1380dup
ZMYND11 transcript variant 32 NM_001370119.2:c.*1364_*1380= NM_001370119.2:c.*1369_*1380dup
ZMYND11 transcript variant 32 NM_001370119.1:c.*1364_*1380= NM_001370119.1:c.*1369_*1380dup
ZMYND11 transcript variant 18 NM_001370105.2:c.*1364_*1380= NM_001370105.2:c.*1369_*1380dup
ZMYND11 transcript variant 18 NM_001370105.1:c.*1364_*1380= NM_001370105.1:c.*1369_*1380dup
ZMYND11 transcript variant 25 NM_001370112.2:c.*1364_*1380= NM_001370112.2:c.*1369_*1380dup
ZMYND11 transcript variant 25 NM_001370112.1:c.*1364_*1380= NM_001370112.1:c.*1369_*1380dup
ZMYND11 transcript variant 28 NM_001370115.2:c.*1364_*1380= NM_001370115.2:c.*1369_*1380dup
ZMYND11 transcript variant 28 NM_001370115.1:c.*1364_*1380= NM_001370115.1:c.*1369_*1380dup
ZMYND11 transcript variant 16 NM_001370103.2:c.*1364_*1380= NM_001370103.2:c.*1369_*1380dup
ZMYND11 transcript variant 16 NM_001370103.1:c.*1364_*1380= NM_001370103.1:c.*1369_*1380dup
ZMYND11 transcript variant 14 NM_001370101.2:c.*1364_*1380= NM_001370101.2:c.*1369_*1380dup
ZMYND11 transcript variant 14 NM_001370101.1:c.*1364_*1380= NM_001370101.1:c.*1369_*1380dup
ZMYND11 transcript variant 12 NM_001370099.2:c.*1364_*1380= NM_001370099.2:c.*1369_*1380dup
ZMYND11 transcript variant 12 NM_001370099.1:c.*1364_*1380= NM_001370099.1:c.*1369_*1380dup
ZMYND11 transcript variant 38 NR_163254.2:n.3204_3220= NR_163254.2:n.3209_3220dup
ZMYND11 transcript variant 38 NR_163254.1:n.3204_3220= NR_163254.1:n.3209_3220dup
ZMYND11 transcript variant 29 NM_001370116.2:c.*1364_*1380= NM_001370116.2:c.*1369_*1380dup
ZMYND11 transcript variant 29 NM_001370116.1:c.*1364_*1380= NM_001370116.1:c.*1369_*1380dup
ZMYND11 transcript variant 27 NM_001370114.2:c.*1364_*1380= NM_001370114.2:c.*1369_*1380dup
ZMYND11 transcript variant 27 NM_001370114.1:c.*1364_*1380= NM_001370114.1:c.*1369_*1380dup
ZMYND11 transcript variant 30 NM_001370117.2:c.*1364_*1380= NM_001370117.2:c.*1369_*1380dup
ZMYND11 transcript variant 30 NM_001370117.1:c.*1364_*1380= NM_001370117.1:c.*1369_*1380dup
ZMYND11 transcript variant 19 NM_001370106.2:c.*1364_*1380= NM_001370106.2:c.*1369_*1380dup
ZMYND11 transcript variant 19 NM_001370106.1:c.*1364_*1380= NM_001370106.1:c.*1369_*1380dup
ZMYND11 transcript variant 17 NM_001370104.2:c.*1364_*1380= NM_001370104.2:c.*1369_*1380dup
ZMYND11 transcript variant 17 NM_001370104.1:c.*1364_*1380= NM_001370104.1:c.*1369_*1380dup
ZMYND11 transcript variant 21 NM_001370108.2:c.*1364_*1380= NM_001370108.2:c.*1369_*1380dup
ZMYND11 transcript variant 21 NM_001370108.1:c.*1364_*1380= NM_001370108.1:c.*1369_*1380dup
ZMYND11 transcript variant 24 NM_001370111.2:c.*1364_*1380= NM_001370111.2:c.*1369_*1380dup
ZMYND11 transcript variant 24 NM_001370111.1:c.*1364_*1380= NM_001370111.1:c.*1369_*1380dup
ZMYND11 transcript variant 33 NM_001370120.2:c.*1364_*1380= NM_001370120.2:c.*1369_*1380dup
ZMYND11 transcript variant 33 NM_001370120.1:c.*1364_*1380= NM_001370120.1:c.*1369_*1380dup
ZMYND11 transcript variant 36 NM_001370123.2:c.*1364_*1380= NM_001370123.2:c.*1369_*1380dup
ZMYND11 transcript variant 36 NM_001370123.1:c.*1364_*1380= NM_001370123.1:c.*1369_*1380dup
ZMYND11 transcript variant 35 NM_001370122.2:c.*1364_*1380= NM_001370122.2:c.*1369_*1380dup
ZMYND11 transcript variant 35 NM_001370122.1:c.*1364_*1380= NM_001370122.1:c.*1369_*1380dup
ZMYND11 transcript variant 23 NM_001370110.2:c.*1364_*1380= NM_001370110.2:c.*1369_*1380dup
ZMYND11 transcript variant 23 NM_001370110.1:c.*1364_*1380= NM_001370110.1:c.*1369_*1380dup
ZMYND11 transcript variant 34 NM_001370121.2:c.*1364_*1380= NM_001370121.2:c.*1369_*1380dup
ZMYND11 transcript variant 34 NM_001370121.1:c.*1364_*1380= NM_001370121.1:c.*1369_*1380dup
ZMYND11 transcript variant 3 NM_001161482.1:c.*1364_*1380= NM_001161482.1:c.*1369_*1380dup
ZMYND11 transcript variant X12 XM_017015594.1:c.*1364_*1380= XM_017015594.1:c.*1369_*1380dup
Help

Submissions tab displays variations originally submitted to dbSNP, now supporting this RefSNP cluster (rs). We display Submitter handle, Submission identifier, Date and Build number, when the submission appeared for the first time. Direct submissions to dbSNP have Submission ID in the form of an ss-prefixed number (ss#). Other supporting variations are listed in the table without ss#.

4 SubSNP, 3 Frequency submissions
No Submitter Submission ID Date (Build)
1 TOPMED ss2136342938 Dec 20, 2016 (150)
2 GNOMAD ss2884533135 Nov 08, 2017 (151)
3 TOPMED ss3109364752 Nov 08, 2017 (151)
4 TOPMED ss4839567740 Apr 26, 2021 (155)
5 gnomAD - Genomes NC_000010.11 - 253834 Apr 26, 2021 (155)
6 TopMed NC_000010.11 - 253834 Apr 26, 2021 (155)
7 ALFA NC_000010.11 - 253834 Apr 26, 2021 (155)
Help

History tab displays RefSNPs (Associated ID) from previous builds (Build) that now support the current RefSNP, and the dates, when the history was updated for each Associated ID (History Updated).

Added to this RefSNP Cluster:
Submission IDs Observation SPDI Canonical SPDI Source RSIDs
ss2136342938, ss2884533135 NC_000010.10:299773::AAAAGCCTTTTA NC_000010.11:253833:AAAAGCCTTTTAAA…

NC_000010.11:253833:AAAAGCCTTTTAAAAAG:AAAAGCCTTTTAAAAAGCCTTTTAAAAAG

(self)
340969875, 34630045, 55113395, ss3109364752, ss4839567740 NC_000010.11:253833::AAAAGCCTTTTA NC_000010.11:253833:AAAAGCCTTTTAAA…

NC_000010.11:253833:AAAAGCCTTTTAAAAAG:AAAAGCCTTTTAAAAAGCCTTTTAAAAAG

(self)
1753207129 NC_000010.11:253833:AAAAGCCTTTTAAA…

NC_000010.11:253833:AAAAGCCTTTTAAAAAG:AAAAGCCTTTTAAAAAGCCTTTTAAAAAG

NC_000010.11:253833:AAAAGCCTTTTAAA…

NC_000010.11:253833:AAAAGCCTTTTAAAAAG:AAAAGCCTTTTAAAAAGCCTTTTAAAAAG

(self)
Help

Publications tab displays PubMed articles citing the variation as a listing of PMID, Title, Author, Year, Journal, ordered by Year, descending.

No publications for rs1011000296

Help

The Flanks tab provides retrieving flanking sequences of a SNP on all molecules that have placements.

Genome context:
Select flank length:

Genomic regions, transcripts, and products
Top Help

NCBI Graphical Sequence Viewer display of the genomic region, transcripts and protein products for the reported RefSNP (rs).
Use the zoom option to view the nucleotides around the RefSNP and find other neighboring RefSNPs.
Visit Sequence Viewer for help with navigating inside the display and modifying the selection of displayed data tracks.

Software version is: 2.0.1.post596+ae089ad