Skip to main page content
Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation

dbSNP Short Genetic Variations

Welcome to the Reference SNP (rs) Report

All alleles are reported in the Forward orientation. Click on the Variant Details tab for details on Genomic Placement, Gene, and Amino Acid changes. HGVS names are in the HGVS tab.

Reference SNP (rs) Report

This page reports data for a single dbSNP Reference SNP variation (RefSNP or rs) from the new redesigned dbSNP build.
Top of the page reports a concise summary for the rs, with more specific details included in the corresponding tabs below.
All alleles are reported in the Forward orientation. Use the Genomic View to inspect the nucleotides flanking the variant, and its neighbors.
For more information see Help documentation.

rs1034844176

Current Build 155

Released April 9, 2021

Organism
Homo sapiens
Position
chr10:289207-289219 (GRCh38.p13) Help

The anchor position for this RefSNP. Includes all nucleotides potentially affected by this change, thus it can differ from HGVS, which is right-shifted. See here for details.

Alleles
delACAGGGTGCGG / dupACAGGGTGCGG
Variation Type
Indel Insertion and Deletion
Frequency
delACAGGGTGCGG=0.000004 (1/264690, TOPMED)
dupACAGGGTGCGG=0.00006 (1/16332, ALFA)
dupACAGGGTGCGG=0.0002 (1/4480, Estonian)
Clinical Significance
Not Reported in ClinVar
Gene : Consequence
DIP2C : Intron Variant
Publications
0 citations
Genomic View
See rs on genome
Help

Variant Details tab shows known variant placements on genomic sequences: chromosomes (NC_), RefSeqGene, pseudogenes or genomic regions (NG_), and in a separate table: on transcripts (NM_) and protein sequences (NP_). The corresponding transcript and protein locations are listed in adjacent lines, along with molecular consequences from Sequence Ontology. When no protein placement is available, only the transcript is listed. Column "Codon[Amino acid]" shows the actual base change in the format of "Reference > Alternate" allele, including the nucleotide codon change in transcripts, and the amino acid change in proteins, respectively, allowing for known ribosomal slippage sites. To view nucleotides adjacent to the variant use the Genomic View at the bottom of the page - zoom into the sequence until the nucleotides around the variant become visible.

Genomic Placements
Sequence name Change
GRCh38.p13 chr 10 NC_000010.11:g.289209_289219del
GRCh38.p13 chr 10 NC_000010.11:g.289209_289219dup
GRCh37.p13 chr 10 NC_000010.10:g.335149_335159del
GRCh37.p13 chr 10 NC_000010.10:g.335149_335159dup
Gene: DIP2C, disco interacting protein 2 homolog C (minus strand)
Molecule type Change Amino acid[Codon] SO Term
DIP2C transcript NM_014974.3:c.3987-796_39…

NM_014974.3:c.3987-796_3987-786del

N/A Intron Variant
DIP2C transcript variant X4 XM_005252426.3:c.4155-796…

XM_005252426.3:c.4155-796_4155-786del

N/A Intron Variant
DIP2C transcript variant X6 XM_005252427.4:c.4017-796…

XM_005252427.4:c.4017-796_4017-786del

N/A Intron Variant
DIP2C transcript variant X2 XM_005252428.4:c.4185-796…

XM_005252428.4:c.4185-796_4185-786del

N/A Intron Variant
DIP2C transcript variant X10 XM_005252430.3:c.2298-796…

XM_005252430.3:c.2298-796_2298-786del

N/A Intron Variant
DIP2C transcript variant X1 XM_011519428.3:c.4197-796…

XM_011519428.3:c.4197-796_4197-786del

N/A Intron Variant
DIP2C transcript variant X3 XM_011519429.3:c.4167-796…

XM_011519429.3:c.4167-796_4167-786del

N/A Intron Variant
DIP2C transcript variant X5 XM_011519430.2:c.4029-796…

XM_011519430.2:c.4029-796_4029-786del

N/A Intron Variant
DIP2C transcript variant X7 XM_011519431.2:c.3999-796…

XM_011519431.2:c.3999-796_3999-786del

N/A Intron Variant
DIP2C transcript variant X8 XM_011519432.2:c.3696-796…

XM_011519432.2:c.3696-796_3696-786del

N/A Intron Variant
DIP2C transcript variant X11 XM_011519433.3:c.1980-796…

XM_011519433.3:c.1980-796_1980-786del

N/A Intron Variant
DIP2C transcript variant X9 XM_017015977.1:c.2328-796…

XM_017015977.1:c.2328-796_2328-786del

N/A Intron Variant
Help

Clinical Significance tab shows a list of clinical significance entries from ClinVar associated with the variation, per allele. Click on the RCV accession (i.e. RCV000001615.2) or Allele ID (i.e. 12274) to access full ClinVar report.

Not Reported in ClinVar

ALFA Allele Frequency
The ALFA project provide aggregate allele frequency from dbGaP. More information is available on the project page including descriptions, data access, and terms of use.

Release Version: 20201027095038
Population Group Sample Size Ref Allele Alt Allele
Total Global 16332 GGACAGGGTGCGG=0.99994 GG=0.00000, GGACAGGGTGCGGACAGGGTGCGG=0.00006
European Sub 12080 GGACAGGGTGCGG=0.99992 GG=0.00000, GGACAGGGTGCGGACAGGGTGCGG=0.00008
African Sub 2816 GGACAGGGTGCGG=1.0000 GG=0.0000, GGACAGGGTGCGGACAGGGTGCGG=0.0000
African Others Sub 108 GGACAGGGTGCGG=1.000 GG=0.000, GGACAGGGTGCGGACAGGGTGCGG=0.000
African American Sub 2708 GGACAGGGTGCGG=1.0000 GG=0.0000, GGACAGGGTGCGGACAGGGTGCGG=0.0000
Asian Sub 108 GGACAGGGTGCGG=1.000 GG=0.000, GGACAGGGTGCGGACAGGGTGCGG=0.000
East Asian Sub 84 GGACAGGGTGCGG=1.00 GG=0.00, GGACAGGGTGCGGACAGGGTGCGG=0.00
Other Asian Sub 24 GGACAGGGTGCGG=1.00 GG=0.00, GGACAGGGTGCGGACAGGGTGCGG=0.00
Latin American 1 Sub 146 GGACAGGGTGCGG=1.000 GG=0.000, GGACAGGGTGCGGACAGGGTGCGG=0.000
Latin American 2 Sub 610 GGACAGGGTGCGG=1.000 GG=0.000, GGACAGGGTGCGGACAGGGTGCGG=0.000
South Asian Sub 94 GGACAGGGTGCGG=1.00 GG=0.00, GGACAGGGTGCGGACAGGGTGCGG=0.00
Other Sub 478 GGACAGGGTGCGG=1.000 GG=0.000, GGACAGGGTGCGGACAGGGTGCGG=0.000


Help

Frequency tab displays a table of the reference and alternate allele frequencies reported by various studies and populations. Table lines, where Population="Global" refer to the entire study population, whereas lines, where Group="Sub", refer to a study-specific population subgroupings (i.e. AFR, CAU, etc.), if available. Frequency for the alternate allele (Alt Allele) is a ratio of samples observed-to-total, where the numerator (observed samples) is the number of chromosomes in the study with the minor allele present (found in "Sample size", where Group="Sub"), and the denominator (total samples) is the total number of all chromosomes in the study for the variant (found in "Sample size", where Group="Study-wide" and Population="Global").

Download
Study Population Group Sample Size Ref Allele Alt Allele
TopMed Global Study-wide 264690 GGACAGGGTGCGG=0.999996 delACAGGGTGCGG=0.000004
Genetic variation in the Estonian population Estonian Study-wide 4480 -

No frequency provided

dupACAGGGTGCGG=0.0002
Help

Aliases tab displays HGVS names representing the variant placements and allele changes on genomic, transcript and protein sequences, per allele. HGVS name is an expression for reporting sequence accession and version, sequence type, position, and allele change. The column "Note" can have two values: "diff" means that there is a difference between the reference allele (variation interval) at the placement reported in HGVS name and the reference alleles reported in other HGVS names, and "rev" means that the sequence of this variation interval at the placement reported in HGVS name is in reverse orientation to the sequence(s) of this variation in other HGVS names not labeled as "rev".

Placement GGACAGGGTGCGG= delACAGGGTGCGG dupACAGGGTGCGG
GRCh38.p13 chr 10 NC_000010.11:g.289207_289219= NC_000010.11:g.289209_289219del NC_000010.11:g.289209_289219dup
GRCh37.p13 chr 10 NC_000010.10:g.335147_335159= NC_000010.10:g.335149_335159del NC_000010.10:g.335149_335159dup
DIP2C transcript NM_014974.2:c.3987-786= NM_014974.2:c.3987-796_3987-786del NM_014974.2:c.3987-796_3987-786dup
DIP2C transcript NM_014974.3:c.3987-786= NM_014974.3:c.3987-796_3987-786del NM_014974.3:c.3987-796_3987-786dup
DIP2C transcript variant X1 XM_005252426.1:c.4155-786= XM_005252426.1:c.4155-796_4155-786del XM_005252426.1:c.4155-796_4155-786dup
DIP2C transcript variant X4 XM_005252426.3:c.4155-786= XM_005252426.3:c.4155-796_4155-786del XM_005252426.3:c.4155-796_4155-786dup
DIP2C transcript variant X2 XM_005252427.1:c.4017-786= XM_005252427.1:c.4017-796_4017-786del XM_005252427.1:c.4017-796_4017-786dup
DIP2C transcript variant X6 XM_005252427.4:c.4017-786= XM_005252427.4:c.4017-796_4017-786del XM_005252427.4:c.4017-796_4017-786dup
DIP2C transcript variant X3 XM_005252428.1:c.4185-786= XM_005252428.1:c.4185-796_4185-786del XM_005252428.1:c.4185-796_4185-786dup
DIP2C transcript variant X2 XM_005252428.4:c.4185-786= XM_005252428.4:c.4185-796_4185-786del XM_005252428.4:c.4185-796_4185-786dup
DIP2C transcript variant X4 XM_005252429.1:c.3540-786= XM_005252429.1:c.3540-796_3540-786del XM_005252429.1:c.3540-796_3540-786dup
DIP2C transcript variant X8 XM_005252430.1:c.2076-786= XM_005252430.1:c.2076-796_2076-786del XM_005252430.1:c.2076-796_2076-786dup
DIP2C transcript variant X10 XM_005252430.3:c.2298-786= XM_005252430.3:c.2298-796_2298-786del XM_005252430.3:c.2298-796_2298-786dup
DIP2C transcript variant X1 XM_011519428.3:c.4197-786= XM_011519428.3:c.4197-796_4197-786del XM_011519428.3:c.4197-796_4197-786dup
DIP2C transcript variant X3 XM_011519429.3:c.4167-786= XM_011519429.3:c.4167-796_4167-786del XM_011519429.3:c.4167-796_4167-786dup
DIP2C transcript variant X5 XM_011519430.2:c.4029-786= XM_011519430.2:c.4029-796_4029-786del XM_011519430.2:c.4029-796_4029-786dup
DIP2C transcript variant X7 XM_011519431.2:c.3999-786= XM_011519431.2:c.3999-796_3999-786del XM_011519431.2:c.3999-796_3999-786dup
DIP2C transcript variant X8 XM_011519432.2:c.3696-786= XM_011519432.2:c.3696-796_3696-786del XM_011519432.2:c.3696-796_3696-786dup
DIP2C transcript variant X11 XM_011519433.3:c.1980-786= XM_011519433.3:c.1980-796_1980-786del XM_011519433.3:c.1980-796_1980-786dup
DIP2C transcript variant X9 XM_017015977.1:c.2328-786= XM_017015977.1:c.2328-796_2328-786del XM_017015977.1:c.2328-796_2328-786dup
Help

Submissions tab displays variations originally submitted to dbSNP, now supporting this RefSNP cluster (rs). We display Submitter handle, Submission identifier, Date and Build number, when the submission appeared for the first time. Direct submissions to dbSNP have Submission ID in the form of an ss-prefixed number (ss#). Other supporting variations are listed in the table without ss#.

6 SubSNP, 5 Frequency submissions
No Submitter Submission ID Date (Build)
1 TOPMED ss2136342942 Dec 20, 2016 (150)
2 TOPMED ss3109372543 Nov 08, 2017 (151)
3 EGCUT_WGS ss3673317188 Jul 13, 2019 (153)
4 GNOMAD ss4211445122 Apr 26, 2021 (155)
5 GNOMAD ss4211445123 Apr 26, 2021 (155)
6 TOPMED ss4839577982 Apr 26, 2021 (155)
7 Genetic variation in the Estonian population NC_000010.10 - 335147 Oct 12, 2018 (152)
8 gnomAD - Genomes

Submission ignored due to conflicting rows:
Row 340978387 (NC_000010.11:289206::GGACAGGGTGC 5/139238)
Row 340978388 (NC_000010.11:289206:GGACAGGGTGC: 1/139238)

- Apr 26, 2021 (155)
9 gnomAD - Genomes

Submission ignored due to conflicting rows:
Row 340978387 (NC_000010.11:289206::GGACAGGGTGC 5/139238)
Row 340978388 (NC_000010.11:289206:GGACAGGGTGC: 1/139238)

- Apr 26, 2021 (155)
10 TopMed NC_000010.11 - 289207 Apr 26, 2021 (155)
11 ALFA NC_000010.11 - 289207 Apr 26, 2021 (155)
Help

History tab displays RefSNPs (Associated ID) from previous builds (Build) that now support the current RefSNP, and the dates, when the history was updated for each Associated ID (History Updated).

Added to this RefSNP Cluster:
Submission IDs Observation SPDI Canonical SPDI Source RSIDs
55123637, ss4211445123, ss4839577982 NC_000010.11:289206:GGACAGGGTGC: NC_000010.11:289206:GGACAGGGTGCGG:…

NC_000010.11:289206:GGACAGGGTGCGG:GG

11351410633 NC_000010.11:289206:GGACAGGGTGCGG:…

NC_000010.11:289206:GGACAGGGTGCGG:GG

NC_000010.11:289206:GGACAGGGTGCGG:…

NC_000010.11:289206:GGACAGGGTGCGG:GG

19055436, ss2136342942, ss3673317188 NC_000010.10:335146::GGACAGGGTGC NC_000010.11:289206:GGACAGGGTGCGG:…

NC_000010.11:289206:GGACAGGGTGCGG:GGACAGGGTGCGGACAGGGTGCGG

(self)
ss3109372543, ss4211445122 NC_000010.11:289206::GGACAGGGTGC NC_000010.11:289206:GGACAGGGTGCGG:…

NC_000010.11:289206:GGACAGGGTGCGG:GGACAGGGTGCGGACAGGGTGCGG

(self)
11351410633 NC_000010.11:289206:GGACAGGGTGCGG:…

NC_000010.11:289206:GGACAGGGTGCGG:GGACAGGGTGCGGACAGGGTGCGG

NC_000010.11:289206:GGACAGGGTGCGG:…

NC_000010.11:289206:GGACAGGGTGCGG:GGACAGGGTGCGGACAGGGTGCGG

Help

Publications tab displays PubMed articles citing the variation as a listing of PMID, Title, Author, Year, Journal, ordered by Year, descending.

No publications for rs1034844176

Help

The Flanks tab provides retrieving flanking sequences of a SNP on all molecules that have placements.

Genome context:
Select flank length:

Genomic regions, transcripts, and products
Top Help

NCBI Graphical Sequence Viewer display of the genomic region, transcripts and protein products for the reported RefSNP (rs).
Use the zoom option to view the nucleotides around the RefSNP and find other neighboring RefSNPs.
Visit Sequence Viewer for help with navigating inside the display and modifying the selection of displayed data tracks.

Software version is: 2.0.1.post596+ae089ad