Skip to main page content
Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation

dbSNP Short Genetic Variations

Welcome to the Reference SNP (rs) Report

All alleles are reported in the Forward orientation. Click on the Variant Details tab for details on Genomic Placement, Gene, and Amino Acid changes. HGVS names are in the HGVS tab.

Reference SNP (rs) Report

This page reports data for a single dbSNP Reference SNP variation (RefSNP or rs) from the new redesigned dbSNP build.
Top of the page reports a concise summary for the rs, with more specific details included in the corresponding tabs below.
All alleles are reported in the Forward orientation. Use the Genomic View to inspect the nucleotides flanking the variant, and its neighbors.
For more information see Help documentation.


Current Build 155

Released April 9, 2021

Homo sapiens
chr1:6107605-6107606 (GRCh38.p13) Help

The anchor position for this RefSNP. Includes all nucleotides potentially affected by this change, thus it can differ from HGVS, which is right-shifted. See here for details.



Variation Type
insAAGGGATGTAGGG(ATG)2AAGGG(ATG)2=0.108 (64/592, NorthernSweden)
Clinical Significance
Not Reported in ClinVar
Gene : Consequence
CHD5 : Intron Variant
0 citations
Genomic View
See rs on genome

Variant Details tab shows known variant placements on genomic sequences: chromosomes (NC_), RefSeqGene, pseudogenes or genomic regions (NG_), and in a separate table: on transcripts (NM_) and protein sequences (NP_). The corresponding transcript and protein locations are listed in adjacent lines, along with molecular consequences from Sequence Ontology. When no protein placement is available, only the transcript is listed. Column "Codon[Amino acid]" shows the actual base change in the format of "Reference > Alternate" allele, including the nucleotide codon change in transcripts, and the amino acid change in proteins, respectively, allowing for known ribosomal slippage sites. To view nucleotides adjacent to the variant use the Genomic View at the bottom of the page - zoom into the sequence until the nucleotides around the variant become visible.

Genomic Placements
Sequence name Change
GRCh38.p13 chr 1 NC_000001.11:g.6107605_6107606insAAGGGATGTAGGGAGGATGAAGGGATGATG
GRCh38.p13 chr 1 NC_000001.11:g.6107605_6107606insAAGGGATGTAGGGATGATGAAGGGAGGATG
GRCh38.p13 chr 1 NC_000001.11:g.6107605_6107606insAAGGGATGTAGGGATGATGAAGGGATGACG
GRCh38.p13 chr 1 NC_000001.11:g.6107605_6107606insAAGGGATGTAGGGATGATGAAGGGATGATG
GRCh38.p13 chr 1 NC_000001.11:g.6107605_6107606insAAGGGTTGTAGGGGGGATGAAGGGATGATG
GRCh37.p13 chr 1 NC_000001.10:g.6167665_6167666insAAGGGATGTAGGGAGGATGAAGGGATGATG
GRCh37.p13 chr 1 NC_000001.10:g.6167665_6167666insAAGGGATGTAGGGATGATGAAGGGAGGATG
GRCh37.p13 chr 1 NC_000001.10:g.6167665_6167666insAAGGGATGTAGGGATGATGAAGGGATGACG
GRCh37.p13 chr 1 NC_000001.10:g.6167665_6167666insAAGGGATGTAGGGATGATGAAGGGATGATG
GRCh37.p13 chr 1 NC_000001.10:g.6167665_6167666insAAGGGTTGTAGGGGGGATGAAGGGATGATG
Gene: CHD5, chromodomain helicase DNA binding protein 5 (minus strand)
Molecule type Change Amino acid[Codon] SO Term
CHD5 transcript NM_015557.3:c.5579-827_55…


N/A Intron Variant

Clinical Significance tab shows a list of clinical significance entries from ClinVar associated with the variation, per allele. Click on the RCV accession (i.e. RCV000001615.2) or Allele ID (i.e. 12274) to access full ClinVar report.

Not Reported in ClinVar

Frequency tab displays a table of the reference and alternate allele frequencies reported by various studies and populations. Table lines, where Population="Global" refer to the entire study population, whereas lines, where Group="Sub", refer to a study-specific population subgroupings (i.e. AFR, CAU, etc.), if available. Frequency for the alternate allele (Alt Allele) is a ratio of samples observed-to-total, where the numerator (observed samples) is the number of chromosomes in the study with the minor allele present (found in "Sample size", where Group="Sub"), and the denominator (total samples) is the total number of all chromosomes in the study for the variant (found in "Sample size", where Group="Study-wide" and Population="Global").

Study Population Group Sample Size Ref Allele Alt Allele
Northern Sweden ACPOP Study-wide 592 -

No frequency provided


Aliases tab displays HGVS names representing the variant placements and allele changes on genomic, transcript and protein sequences, per allele. HGVS name is an expression for reporting sequence accession and version, sequence type, position, and allele change. The column "Note" can have two values: "diff" means that there is a difference between the reference allele (variation interval) at the placement reported in HGVS name and the reference alleles reported in other HGVS names, and "rev" means that the sequence of this variation interval at the placement reported in HGVS name is in reverse orientation to the sequence(s) of this variation in other HGVS names not labeled as "rev".

GRCh38.p13 chr 1 NC_000001.11:g.6107605_6107606= NC_000001.11:g.6107605_6107606insAAGGGATGTAGGGAGGATGAAGGGATGATG NC_000001.11:g.6107605_6107606insAAGGGATGTAGGGATGATGAAGGGAGGATG NC_000001.11:g.6107605_6107606insAAGGGATGTAGGGATGATGAAGGGATGACG NC_000001.11:g.6107605_6107606insAAGGGATGTAGGGATGATGAAGGGATGATG NC_000001.11:g.6107605_6107606insAAGGGTTGTAGGGGGGATGAAGGGATGATG
GRCh37.p13 chr 1 NC_000001.10:g.6167665_6167666= NC_000001.10:g.6167665_6167666insAAGGGATGTAGGGAGGATGAAGGGATGATG NC_000001.10:g.6167665_6167666insAAGGGATGTAGGGATGATGAAGGGAGGATG NC_000001.10:g.6167665_6167666insAAGGGATGTAGGGATGATGAAGGGATGACG NC_000001.10:g.6167665_6167666insAAGGGATGTAGGGATGATGAAGGGATGATG NC_000001.10:g.6167665_6167666insAAGGGTTGTAGGGGGGATGAAGGGATGATG
CHD5 transcript NM_015557.2:c.5579-827= NM_015557.2:c.5579-827_5579-826insCATCATCCCTTCATCCTCCCTACATCCCTT NM_015557.2:c.5579-827_5579-826insCATCCTCCCTTCATCATCCCTACATCCCTT NM_015557.2:c.5579-827_5579-826insCGTCATCCCTTCATCATCCCTACATCCCTT NM_015557.2:c.5579-827_5579-826insCATCATCCCTTCATCATCCCTACATCCCTT NM_015557.2:c.5579-827_5579-826insCATCATCCCTTCATCCCCCCTACAACCCTT
CHD5 transcript NM_015557.3:c.5579-827= NM_015557.3:c.5579-827_5579-826insCATCATCCCTTCATCCTCCCTACATCCCTT NM_015557.3:c.5579-827_5579-826insCATCCTCCCTTCATCATCCCTACATCCCTT NM_015557.3:c.5579-827_5579-826insCGTCATCCCTTCATCATCCCTACATCCCTT NM_015557.3:c.5579-827_5579-826insCATCATCCCTTCATCATCCCTACATCCCTT NM_015557.3:c.5579-827_5579-826insCATCATCCCTTCATCCCCCCTACAACCCTT

Submissions tab displays variations originally submitted to dbSNP, now supporting this RefSNP cluster (rs). We display Submitter handle, Submission identifier, Date and Build number, when the submission appeared for the first time. Direct submissions to dbSNP have Submission ID in the form of an ss-prefixed number (ss#). Other supporting variations are listed in the table without ss#.

15 SubSNP, 9 Frequency submissions
No Submitter Submission ID Date (Build)
1 SYSTEMSBIOZJU ss2137334791 Nov 08, 2017 (151)
2 MCHAISSO ss3063575217 Nov 08, 2017 (151)
3 MCHAISSO ss3063575218 Nov 08, 2017 (151)
4 MCHAISSO ss3065284800 Nov 08, 2017 (151)
5 ACPOP ss3726758247 Jul 12, 2019 (153)
6 PACBIO ss3783314522 Jul 12, 2019 (153)
7 EVA ss3826005346 Apr 25, 2020 (154)
8 KOGIC ss3943735550 Apr 25, 2020 (154)
9 KOGIC ss3943735551 Apr 25, 2020 (154)
10 GNOMAD ss3987672278 Apr 25, 2021 (155)
11 GNOMAD ss3987672279 Apr 25, 2021 (155)
12 GNOMAD ss3987672280 Apr 25, 2021 (155)
13 GNOMAD ss3987672281 Apr 25, 2021 (155)
14 TOMMO_GENOMICS ss5142290016 Apr 25, 2021 (155)
15 TOMMO_GENOMICS ss5142290017 Apr 25, 2021 (155)
16 gnomAD - Genomes

Submission ignored due to conflicting rows:
Row 1387589 (NC_000001.11:6107605::AAGGGATGTAGGGAGGATGAAGGGATGATG 1/120904)
Row 1387590 (NC_000001.11:6107605::AAGGGATGTAGGGATGATGAAGGGAGGATG 1/120904)
Row 1387591 (NC_000001.11:6107605::AAGGGATGTAGGGATGATGAAGGGATGATG 8815/118944)...

- Apr 25, 2021 (155)
17 gnomAD - Genomes

Submission ignored due to conflicting rows:
Row 1387589 (NC_000001.11:6107605::AAGGGATGTAGGGAGGATGAAGGGATGATG 1/120904)
Row 1387590 (NC_000001.11:6107605::AAGGGATGTAGGGATGATGAAGGGAGGATG 1/120904)
Row 1387591 (NC_000001.11:6107605::AAGGGATGTAGGGATGATGAAGGGATGATG 8815/118944)...

- Apr 25, 2021 (155)
18 gnomAD - Genomes

Submission ignored due to conflicting rows:
Row 1387589 (NC_000001.11:6107605::AAGGGATGTAGGGAGGATGAAGGGATGATG 1/120904)
Row 1387590 (NC_000001.11:6107605::AAGGGATGTAGGGATGATGAAGGGAGGATG 1/120904)
Row 1387591 (NC_000001.11:6107605::AAGGGATGTAGGGATGATGAAGGGATGATG 8815/118944)...

- Apr 25, 2021 (155)
19 gnomAD - Genomes

Submission ignored due to conflicting rows:
Row 1387589 (NC_000001.11:6107605::AAGGGATGTAGGGAGGATGAAGGGATGATG 1/120904)
Row 1387590 (NC_000001.11:6107605::AAGGGATGTAGGGATGATGAAGGGAGGATG 1/120904)
Row 1387591 (NC_000001.11:6107605::AAGGGATGTAGGGATGATGAAGGGATGATG 8815/118944)...

- Apr 25, 2021 (155)
20 Korean Genome Project

Submission ignored due to conflicting rows:
Row 113551 (NC_000001.11:6107605::AAGGGATGTAGGGATGATGAAGGGATGATG 656/1794)
Row 113552 (NC_000001.11:6107605::AAGGGATGTAGGGATGATGAAGGGATGACG 1/1794)

- Apr 25, 2020 (154)
21 Korean Genome Project

Submission ignored due to conflicting rows:
Row 113551 (NC_000001.11:6107605::AAGGGATGTAGGGATGATGAAGGGATGATG 656/1794)
Row 113552 (NC_000001.11:6107605::AAGGGATGTAGGGATGATGAAGGGATGACG 1/1794)

- Apr 25, 2020 (154)
22 Northern Sweden NC_000001.10 - 6167666 Jul 12, 2019 (153)
23 8.3KJPN

Submission ignored due to conflicting rows:
Row 259323 (NC_000001.10:6167665::AAGGGATGTAGGGATGATGAAGGGATGATG 5957/16002)
Row 259324 (NC_000001.10:6167665::AAGGGATGTAGGGATGATGAAGGGATGACG 17/16002)

- Apr 25, 2021 (155)
24 8.3KJPN

Submission ignored due to conflicting rows:
Row 259323 (NC_000001.10:6167665::AAGGGATGTAGGGATGATGAAGGGATGATG 5957/16002)
Row 259324 (NC_000001.10:6167665::AAGGGATGTAGGGATGATGAAGGGATGACG 17/16002)

- Apr 25, 2021 (155)

History tab displays RefSNPs (Associated ID) from previous builds (Build) that now support the current RefSNP, and the dates, when the history was updated for each Associated ID (History Updated).

Added to this RefSNP Cluster:
Submission IDs Observation SPDI Canonical SPDI Source RSIDs
ss3987672278 NC_000001.11:6107605::AAGGGATGTAGG…




ss3987672279 NC_000001.11:6107605::AAGGGATGTAGG…




ss5142290017 NC_000001.10:6167665::AAGGGATGTAGG…




ss3943735551 NC_000001.11:6107605::AAGGGATGTAGG…




43112, ss2137334791, ss3726758247, ss3783314522, ss3826005346, ss5142290016 NC_000001.10:6167665::AAGGGATGTAGG…




ss3063575217, ss3063575218, ss3065284800, ss3943735550, ss3987672280 NC_000001.11:6107605::AAGGGATGTAGG…




ss3987672281 NC_000001.11:6107605::AAGGGTTGTAGG…





Publications tab displays PubMed articles citing the variation as a listing of PMID, Title, Author, Year, Journal, ordered by Year, descending.

No publications for rs1164200543


The Flanks tab provides retrieving flanking sequences of a SNP on all molecules that have placements.

Genome context:
Select flank length:

Genomic regions, transcripts, and products
Top Help

NCBI Graphical Sequence Viewer display of the genomic region, transcripts and protein products for the reported RefSNP (rs).
Use the zoom option to view the nucleotides around the RefSNP and find other neighboring RefSNPs.
Visit Sequence Viewer for help with navigating inside the display and modifying the selection of displayed data tracks.

Software version is: 2.0.1.post596+ae089ad