Skip to main page content
Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation

dbSNP Short Genetic Variations

Welcome to the Reference SNP (rs) Report

All alleles are reported in the Forward orientation. Click on the Variant Details tab for details on Genomic Placement, Gene, and Amino Acid changes. HGVS names are in the HGVS tab.

Reference SNP (rs) Report

This page reports data for a single dbSNP Reference SNP variation (RefSNP or rs) from the new redesigned dbSNP build.
Top of the page reports a concise summary for the rs, with more specific details included in the corresponding tabs below.
All alleles are reported in the Forward orientation. Use the Genomic View to inspect the nucleotides flanking the variant, and its neighbors.
For more information see Help documentation.

rs1396915301

Current Build 155

Released April 9, 2021

Organism
Homo sapiens
Position
chr1:6107697-6107716 (GRCh38.p13) Help

The anchor position for this RefSNP. Includes all nucleotides potentially affected by this change, thus it can differ from HGVS, which is right-shifted. See here for details.

Alleles
insAATAAGAGAGGGA(GGAT)2GATGGAGAGAT…

insAATAAGAGAGGGA(GGAT)2GATGGAGAGATGGAGG / ins(AAT)2AGAG(GGA)2TGG(ATG)2(GA)3TGGAGG / ins(AAT)2AGAG(GGATGAT)2GGAGAGATGGAGG / ins(AAT)2AGAG(GGATGAT)2GGAGAG(ATGGAGGGATG)2AGGG(ATGATGG)2AGAGATGGAGG / ins(AAT)2AGAG(GGATGAT)2GGAGAGATGGAGGGATGATT(GAGGGAT)2(GATG)2ATGGAGAGATGGAGG / ins(AAT)2AGAGGGTT(GATG)2ATGGAGAGATGGAGG / ins(AAT)2GGAGGG(ATGATGG)2AGAGATGGAGG / ins(AAT)2TGAGGG(ATGATGG)2AGAGATGGAGG

Variation Type
Indel Insertion and Deletion
Frequency
ins(AAT)2AGAG(GGATGAT)2GGAGAGATGGAGG=0.26842 (4459/16612, 8.3KJPN)
ins(AAT)2AGAG(GGATGAT)2GGAGAGATGGAGG=0.0775 (346/4462, ALFA)
ins(AAT)2AGAG(GGATGAT)2GGAGAGATGGAGG=0.085 (51/600, NorthernSweden)
Clinical Significance
Not Reported in ClinVar
Gene : Consequence
CHD5 : Intron Variant
Publications
0 citations
Genomic View
See rs on genome
Help

Variant Details tab shows known variant placements on genomic sequences: chromosomes (NC_), RefSeqGene, pseudogenes or genomic regions (NG_), and in a separate table: on transcripts (NM_) and protein sequences (NP_). The corresponding transcript and protein locations are listed in adjacent lines, along with molecular consequences from Sequence Ontology. When no protein placement is available, only the transcript is listed. Column "Codon[Amino acid]" shows the actual base change in the format of "Reference > Alternate" allele, including the nucleotide codon change in transcripts, and the amino acid change in proteins, respectively, allowing for known ribosomal slippage sites. To view nucleotides adjacent to the variant use the Genomic View at the bottom of the page - zoom into the sequence until the nucleotides around the variant become visible.

Genomic Placements
Sequence name Change
GRCh38.p13 chr 1 NC_000001.11:g.6107716_6107717insAATAAGAGAGGGAGGATGGATGATGGAGAGATGGAGG
GRCh38.p13 chr 1 NC_000001.11:g.6107716_6107717insAATAATAGAGGGAGGATGGATGATGGAGAGATGGAGG
GRCh38.p13 chr 1 NC_000001.11:g.6107716_6107717insAATAATAGAGGGATGATGGATGATGGAGAGATGGAGG
GRCh38.p13 chr 1 NC_000001.11:g.6107716_6107717insAATAATAGAGGGATGATGGATGATGGAGAGATGGAGGGATGATGGAGGGATGAGGGATGATGGATGATGGAGAGATGGAGG
GRCh38.p13 chr 1 NC_000001.11:g.6107716_6107717insAATAATAGAGGGATGATGGATGATGGAGAGATGGAGGGATGATTGAGGGATGAGGGATGATGGATGATGGAGAGATGGAGG
GRCh38.p13 chr 1 NC_000001.11:g.6107716_6107717insAATAATAGAGGGTTGATGGATGATGGAGAGATGGAGG
GRCh38.p13 chr 1 NC_000001.11:g.6107716_6107717insAATAATGGAGGGATGATGGATGATGGAGAGATGGAGG
GRCh38.p13 chr 1 NC_000001.11:g.6107716_6107717insAATAATTGAGGGATGATGGATGATGGAGAGATGGAGG
GRCh37.p13 chr 1 NC_000001.10:g.6167776_6167777insAATAAGAGAGGGAGGATGGATGATGGAGAGATGGAGG
GRCh37.p13 chr 1 NC_000001.10:g.6167776_6167777insAATAATAGAGGGAGGATGGATGATGGAGAGATGGAGG
GRCh37.p13 chr 1 NC_000001.10:g.6167776_6167777insAATAATAGAGGGATGATGGATGATGGAGAGATGGAGG
GRCh37.p13 chr 1 NC_000001.10:g.6167776_6167777insAATAATAGAGGGATGATGGATGATGGAGAGATGGAGGGATGATGGAGGGATGAGGGATGATGGATGATGGAGAGATGGAGG
GRCh37.p13 chr 1 NC_000001.10:g.6167776_6167777insAATAATAGAGGGATGATGGATGATGGAGAGATGGAGGGATGATTGAGGGATGAGGGATGATGGATGATGGAGAGATGGAGG
GRCh37.p13 chr 1 NC_000001.10:g.6167776_6167777insAATAATAGAGGGTTGATGGATGATGGAGAGATGGAGG
GRCh37.p13 chr 1 NC_000001.10:g.6167776_6167777insAATAATGGAGGGATGATGGATGATGGAGAGATGGAGG
GRCh37.p13 chr 1 NC_000001.10:g.6167776_6167777insAATAATTGAGGGATGATGGATGATGGAGAGATGGAGG
Gene: CHD5, chromodomain helicase DNA binding protein 5 (minus strand)
Molecule type Change Amino acid[Codon] SO Term
CHD5 transcript NM_015557.3:c.5579-918_55…

NM_015557.3:c.5579-918_5579-917insCCTCCATCTCTCCATCATCCATCCTCCCTCTCTTATT

N/A Intron Variant
Help

Clinical Significance tab shows a list of clinical significance entries from ClinVar associated with the variation, per allele. Click on the RCV accession (i.e. RCV000001615.2) or Allele ID (i.e. 12274) to access full ClinVar report.

Not Reported in ClinVar

ALFA Allele Frequency
The ALFA project provide aggregate allele frequency from dbGaP. More information is available on the project page including descriptions, data access, and terms of use.

Release Version: 20201027095038
Population Group Sample Size Ref Allele Alt Allele
Total Global 4462 GGATGATGGAGAGATGGAGG=0.9204 GGATGATGGAGAGATGGAGGAATAATAGAGGGATGATGGATGATGGAGAGATGGAGG=0.0775, GGATGATGGAGAGATGGAGGAATAATAGAGGGATGATGGATGATGGAGAGATGGAGGGATGATGGAGGGATGAGGGATGATGGATGATGGAGAGATGGAGG=0.0020
European Sub 4454 GGATGATGGAGAGATGGAGG=0.9205 GGATGATGGAGAGATGGAGGAATAATAGAGGGATGATGGATGATGGAGAGATGGAGG=0.0775, GGATGATGGAGAGATGGAGGAATAATAGAGGGATGATGGATGATGGAGAGATGGAGGGATGATGGAGGGATGAGGGATGATGGATGATGGAGAGATGGAGG=0.0020
African Sub 0 GGATGATGGAGAGATGGAGG=0 GGATGATGGAGAGATGGAGGAATAATAGAGGGATGATGGATGATGGAGAGATGGAGG=0, GGATGATGGAGAGATGGAGGAATAATAGAGGGATGATGGATGATGGAGAGATGGAGGGATGATGGAGGGATGAGGGATGATGGATGATGGAGAGATGGAGG=0
African Others Sub 0 GGATGATGGAGAGATGGAGG=0 GGATGATGGAGAGATGGAGGAATAATAGAGGGATGATGGATGATGGAGAGATGGAGG=0, GGATGATGGAGAGATGGAGGAATAATAGAGGGATGATGGATGATGGAGAGATGGAGGGATGATGGAGGGATGAGGGATGATGGATGATGGAGAGATGGAGG=0
African American Sub 0 GGATGATGGAGAGATGGAGG=0 GGATGATGGAGAGATGGAGGAATAATAGAGGGATGATGGATGATGGAGAGATGGAGG=0, GGATGATGGAGAGATGGAGGAATAATAGAGGGATGATGGATGATGGAGAGATGGAGGGATGATGGAGGGATGAGGGATGATGGATGATGGAGAGATGGAGG=0
Asian Sub 0 GGATGATGGAGAGATGGAGG=0 GGATGATGGAGAGATGGAGGAATAATAGAGGGATGATGGATGATGGAGAGATGGAGG=0, GGATGATGGAGAGATGGAGGAATAATAGAGGGATGATGGATGATGGAGAGATGGAGGGATGATGGAGGGATGAGGGATGATGGATGATGGAGAGATGGAGG=0
East Asian Sub 0 GGATGATGGAGAGATGGAGG=0 GGATGATGGAGAGATGGAGGAATAATAGAGGGATGATGGATGATGGAGAGATGGAGG=0, GGATGATGGAGAGATGGAGGAATAATAGAGGGATGATGGATGATGGAGAGATGGAGGGATGATGGAGGGATGAGGGATGATGGATGATGGAGAGATGGAGG=0
Other Asian Sub 0 GGATGATGGAGAGATGGAGG=0 GGATGATGGAGAGATGGAGGAATAATAGAGGGATGATGGATGATGGAGAGATGGAGG=0, GGATGATGGAGAGATGGAGGAATAATAGAGGGATGATGGATGATGGAGAGATGGAGGGATGATGGAGGGATGAGGGATGATGGATGATGGAGAGATGGAGG=0
Latin American 1 Sub 0 GGATGATGGAGAGATGGAGG=0 GGATGATGGAGAGATGGAGGAATAATAGAGGGATGATGGATGATGGAGAGATGGAGG=0, GGATGATGGAGAGATGGAGGAATAATAGAGGGATGATGGATGATGGAGAGATGGAGGGATGATGGAGGGATGAGGGATGATGGATGATGGAGAGATGGAGG=0
Latin American 2 Sub 0 GGATGATGGAGAGATGGAGG=0 GGATGATGGAGAGATGGAGGAATAATAGAGGGATGATGGATGATGGAGAGATGGAGG=0, GGATGATGGAGAGATGGAGGAATAATAGAGGGATGATGGATGATGGAGAGATGGAGGGATGATGGAGGGATGAGGGATGATGGATGATGGAGAGATGGAGG=0
South Asian Sub 0 GGATGATGGAGAGATGGAGG=0 GGATGATGGAGAGATGGAGGAATAATAGAGGGATGATGGATGATGGAGAGATGGAGG=0, GGATGATGGAGAGATGGAGGAATAATAGAGGGATGATGGATGATGGAGAGATGGAGGGATGATGGAGGGATGAGGGATGATGGATGATGGAGAGATGGAGG=0
Other Sub 8 GGATGATGGAGAGATGGAGG=0.9 GGATGATGGAGAGATGGAGGAATAATAGAGGGATGATGGATGATGGAGAGATGGAGG=0.1, GGATGATGGAGAGATGGAGGAATAATAGAGGGATGATGGATGATGGAGAGATGGAGGGATGATGGAGGGATGAGGGATGATGGATGATGGAGAGATGGAGG=0.0


Help

Frequency tab displays a table of the reference and alternate allele frequencies reported by various studies and populations. Table lines, where Population="Global" refer to the entire study population, whereas lines, where Group="Sub", refer to a study-specific population subgroupings (i.e. AFR, CAU, etc.), if available. Frequency for the alternate allele (Alt Allele) is a ratio of samples observed-to-total, where the numerator (observed samples) is the number of chromosomes in the study with the minor allele present (found in "Sample size", where Group="Sub"), and the denominator (total samples) is the total number of all chromosomes in the study for the variant (found in "Sample size", where Group="Study-wide" and Population="Global").

Download
Study Population Group Sample Size Ref Allele Alt Allele
8.3KJPN JAPANESE Study-wide 16612 -

No frequency provided

ins(AAT)2AGAG(GGATGAT)2GGAGAGATGGAGG=0.26842
Allele Frequency Aggregator Total Global 4462 GG(ATG)2(GA)3TGGAGG=0.9204 ins(AAT)2AGAG(GGATGAT)2GGAGAGATGGAGG=0.0775, ins(AAT)2AGAG(GGATGAT)2GGAGAG(ATGGAGGGATG)2AGGG(ATGATGG)2AGAGATGGAGG=0.0020
Allele Frequency Aggregator European Sub 4454 GG(ATG)2(GA)3TGGAGG=0.9205 ins(AAT)2AGAG(GGATGAT)2GGAGAGATGGAGG=0.0775, ins(AAT)2AGAG(GGATGAT)2GGAGAG(ATGGAGGGATG)2AGGG(ATGATGG)2AGAGATGGAGG=0.0020
Allele Frequency Aggregator Other Sub 8 GG(ATG)2(GA)3TGGAGG=0.9 ins(AAT)2AGAG(GGATGAT)2GGAGAGATGGAGG=0.1, ins(AAT)2AGAG(GGATGAT)2GGAGAG(ATGGAGGGATG)2AGGG(ATGATGG)2AGAGATGGAGG=0.0
Allele Frequency Aggregator Latin American 1 Sub 0 GG(ATG)2(GA)3TGGAGG=0 ins(AAT)2AGAG(GGATGAT)2GGAGAGATGGAGG=0, ins(AAT)2AGAG(GGATGAT)2GGAGAG(ATGGAGGGATG)2AGGG(ATGATGG)2AGAGATGGAGG=0
Allele Frequency Aggregator Latin American 2 Sub 0 GG(ATG)2(GA)3TGGAGG=0 ins(AAT)2AGAG(GGATGAT)2GGAGAGATGGAGG=0, ins(AAT)2AGAG(GGATGAT)2GGAGAG(ATGGAGGGATG)2AGGG(ATGATGG)2AGAGATGGAGG=0
Allele Frequency Aggregator South Asian Sub 0 GG(ATG)2(GA)3TGGAGG=0 ins(AAT)2AGAG(GGATGAT)2GGAGAGATGGAGG=0, ins(AAT)2AGAG(GGATGAT)2GGAGAG(ATGGAGGGATG)2AGGG(ATGATGG)2AGAGATGGAGG=0
Allele Frequency Aggregator African Sub 0 GG(ATG)2(GA)3TGGAGG=0 ins(AAT)2AGAG(GGATGAT)2GGAGAGATGGAGG=0, ins(AAT)2AGAG(GGATGAT)2GGAGAG(ATGGAGGGATG)2AGGG(ATGATGG)2AGAGATGGAGG=0
Allele Frequency Aggregator Asian Sub 0 GG(ATG)2(GA)3TGGAGG=0 ins(AAT)2AGAG(GGATGAT)2GGAGAGATGGAGG=0, ins(AAT)2AGAG(GGATGAT)2GGAGAG(ATGGAGGGATG)2AGGG(ATGATGG)2AGAGATGGAGG=0
Northern Sweden ACPOP Study-wide 600 -

No frequency provided

ins(AAT)2AGAG(GGATGAT)2GGAGAGATGGAGG=0.085
Help

Aliases tab displays HGVS names representing the variant placements and allele changes on genomic, transcript and protein sequences, per allele. HGVS name is an expression for reporting sequence accession and version, sequence type, position, and allele change. The column "Note" can have two values: "diff" means that there is a difference between the reference allele (variation interval) at the placement reported in HGVS name and the reference alleles reported in other HGVS names, and "rev" means that the sequence of this variation interval at the placement reported in HGVS name is in reverse orientation to the sequence(s) of this variation in other HGVS names not labeled as "rev".

Placement GG(ATG)2(GA)3TGGAGG= insAATAAGAGAGGGA(GGAT)2GATGGAGAGATGGAGG ins(AAT)2AGAG(GGA)2TGG(ATG)2(GA)3TGGAGG ins(AAT)2AGAG(GGATGAT)2GGAGAGATGGAGG ins(AAT)2AGAG(GGATGAT)2GGAGAG(ATGGAGGGATG)2AGGG(ATGATGG)2AGAGATGGAGG ins(AAT)2AGAG(GGATGAT)2GGAGAGATGGAGGGATGATT(GAGGGAT)2(GATG)2ATGGAGAGATGGAGG ins(AAT)2AGAGGGTT(GATG)2ATGGAGAGATGGAGG ins(AAT)2GGAGGG(ATGATGG)2AGAGATGGAGG ins(AAT)2TGAGGG(ATGATGG)2AGAGATGGAGG
GRCh38.p13 chr 1 NC_000001.11:g.6107697_6107716= NC_000001.11:g.6107716_6107717insAATAAGAGAGGGAGGATGGATGATGGAGAGATGGAGG NC_000001.11:g.6107716_6107717insAATAATAGAGGGAGGATGGATGATGGAGAGATGGAGG NC_000001.11:g.6107716_6107717insAATAATAGAGGGATGATGGATGATGGAGAGATGGAGG NC_000001.11:g.6107716_6107717insAATAATAGAGGGATGATGGATGATGGAGAGATGGAGGGATGATGGAGGGATGAGGGATGATGGATGATGGAGAGATGGAGG NC_000001.11:g.6107716_6107717insAATAATAGAGGGATGATGGATGATGGAGAGATGGAGGGATGATTGAGGGATGAGGGATGATGGATGATGGAGAGATGGAGG NC_000001.11:g.6107716_6107717insAATAATAGAGGGTTGATGGATGATGGAGAGATGGAGG NC_000001.11:g.6107716_6107717insAATAATGGAGGGATGATGGATGATGGAGAGATGGAGG NC_000001.11:g.6107716_6107717insAATAATTGAGGGATGATGGATGATGGAGAGATGGAGG
GRCh37.p13 chr 1 NC_000001.10:g.6167757_6167776= NC_000001.10:g.6167776_6167777insAATAAGAGAGGGAGGATGGATGATGGAGAGATGGAGG NC_000001.10:g.6167776_6167777insAATAATAGAGGGAGGATGGATGATGGAGAGATGGAGG NC_000001.10:g.6167776_6167777insAATAATAGAGGGATGATGGATGATGGAGAGATGGAGG NC_000001.10:g.6167776_6167777insAATAATAGAGGGATGATGGATGATGGAGAGATGGAGGGATGATGGAGGGATGAGGGATGATGGATGATGGAGAGATGGAGG NC_000001.10:g.6167776_6167777insAATAATAGAGGGATGATGGATGATGGAGAGATGGAGGGATGATTGAGGGATGAGGGATGATGGATGATGGAGAGATGGAGG NC_000001.10:g.6167776_6167777insAATAATAGAGGGTTGATGGATGATGGAGAGATGGAGG NC_000001.10:g.6167776_6167777insAATAATGGAGGGATGATGGATGATGGAGAGATGGAGG NC_000001.10:g.6167776_6167777insAATAATTGAGGGATGATGGATGATGGAGAGATGGAGG
CHD5 transcript NM_015557.2:c.5579-918= NM_015557.2:c.5579-918_5579-917insCCTCCATCTCTCCATCATCCATCCTCCCTCTCTTATT NM_015557.2:c.5579-918_5579-917insCCTCCATCTCTCCATCATCCATCCTCCCTCTATTATT NM_015557.2:c.5579-918_5579-917insCCTCCATCTCTCCATCATCCATCATCCCTCTATTATT NM_015557.2:c.5579-918_5579-917insCCTCCATCTCTCCATCATCCATCATCCCTCATCCCTCCATCATCCCTCCATCTCTCCATCATCCATCATCCCTCTATTATT NM_015557.2:c.5579-918_5579-917insCCTCCATCTCTCCATCATCCATCATCCCTCATCCCTCAATCATCCCTCCATCTCTCCATCATCCATCATCCCTCTATTATT NM_015557.2:c.5579-918_5579-917insCCTCCATCTCTCCATCATCCATCAACCCTCTATTATT NM_015557.2:c.5579-918_5579-917insCCTCCATCTCTCCATCATCCATCATCCCTCCATTATT NM_015557.2:c.5579-918_5579-917insCCTCCATCTCTCCATCATCCATCATCCCTCAATTATT
CHD5 transcript NM_015557.3:c.5579-918= NM_015557.3:c.5579-918_5579-917insCCTCCATCTCTCCATCATCCATCCTCCCTCTCTTATT NM_015557.3:c.5579-918_5579-917insCCTCCATCTCTCCATCATCCATCCTCCCTCTATTATT NM_015557.3:c.5579-918_5579-917insCCTCCATCTCTCCATCATCCATCATCCCTCTATTATT NM_015557.3:c.5579-918_5579-917insCCTCCATCTCTCCATCATCCATCATCCCTCATCCCTCCATCATCCCTCCATCTCTCCATCATCCATCATCCCTCTATTATT NM_015557.3:c.5579-918_5579-917insCCTCCATCTCTCCATCATCCATCATCCCTCATCCCTCAATCATCCCTCCATCTCTCCATCATCCATCATCCCTCTATTATT NM_015557.3:c.5579-918_5579-917insCCTCCATCTCTCCATCATCCATCAACCCTCTATTATT NM_015557.3:c.5579-918_5579-917insCCTCCATCTCTCCATCATCCATCATCCCTCCATTATT NM_015557.3:c.5579-918_5579-917insCCTCCATCTCTCCATCATCCATCATCCCTCAATTATT
Help

Submissions tab displays variations originally submitted to dbSNP, now supporting this RefSNP cluster (rs). We display Submitter handle, Submission identifier, Date and Build number, when the submission appeared for the first time. Direct submissions to dbSNP have Submission ID in the form of an ss-prefixed number (ss#). Other supporting variations are listed in the table without ss#.

15 SubSNP, 11 Frequency submissions
No Submitter Submission ID Date (Build)
1 SYSTEMSBIOZJU ss2137334792 Nov 08, 2017 (151)
2 BEROUKHIMLAB ss3644052387 Oct 11, 2018 (152)
3 EVA_DECODE ss3686087152 Jul 12, 2019 (153)
4 EVA_DECODE ss3686087154 Jul 12, 2019 (153)
5 EVA_DECODE ss3686087155 Jul 12, 2019 (153)
6 EVA_DECODE ss3686087156 Jul 12, 2019 (153)
7 ACPOP ss3726758248 Jul 12, 2019 (153)
8 INMEGENXS ss3745566068 Jul 12, 2019 (153)
9 KOGIC ss3943735553 Apr 25, 2020 (154)
10 KOGIC ss3943735554 Apr 25, 2020 (154)
11 GNOMAD ss3987672311 Apr 25, 2021 (155)
12 GNOMAD ss3987672312 Apr 25, 2021 (155)
13 GNOMAD ss3987672313 Apr 25, 2021 (155)
14 GNOMAD ss3987672314 Apr 25, 2021 (155)
15 TOMMO_GENOMICS ss5142290030 Apr 25, 2021 (155)
16 gnomAD - Genomes

Submission ignored due to conflicting rows:
Row 1387642 (NC_000001.11:6107696::GGATGATGGAGAGATGGAGGAATAATAGAGGGAGGAT 1/111804)
Row 1387643 (NC_000001.11:6107696::GGATGATGGAGAGATGGAGGAATAATAGAGGGATGAT 11264/111430)
Row 1387644 (NC_000001.11:6107696::GGATGATGGAGAGATGGAGGAATAATAGAGGGATGATGGATGATGGAGAGATGGAGGGATGATGGAGGGATGAGGGATGAT 537/111764)...

- Apr 25, 2021 (155)
17 gnomAD - Genomes

Submission ignored due to conflicting rows:
Row 1387642 (NC_000001.11:6107696::GGATGATGGAGAGATGGAGGAATAATAGAGGGAGGAT 1/111804)
Row 1387643 (NC_000001.11:6107696::GGATGATGGAGAGATGGAGGAATAATAGAGGGATGAT 11264/111430)
Row 1387644 (NC_000001.11:6107696::GGATGATGGAGAGATGGAGGAATAATAGAGGGATGATGGATGATGGAGAGATGGAGGGATGATGGAGGGATGAGGGATGAT 537/111764)...

- Apr 25, 2021 (155)
18 gnomAD - Genomes

Submission ignored due to conflicting rows:
Row 1387642 (NC_000001.11:6107696::GGATGATGGAGAGATGGAGGAATAATAGAGGGAGGAT 1/111804)
Row 1387643 (NC_000001.11:6107696::GGATGATGGAGAGATGGAGGAATAATAGAGGGATGAT 11264/111430)
Row 1387644 (NC_000001.11:6107696::GGATGATGGAGAGATGGAGGAATAATAGAGGGATGATGGATGATGGAGAGATGGAGGGATGATGGAGGGATGAGGGATGAT 537/111764)...

- Apr 25, 2021 (155)
19 gnomAD - Genomes

Submission ignored due to conflicting rows:
Row 1387642 (NC_000001.11:6107696::GGATGATGGAGAGATGGAGGAATAATAGAGGGAGGAT 1/111804)
Row 1387643 (NC_000001.11:6107696::GGATGATGGAGAGATGGAGGAATAATAGAGGGATGAT 11264/111430)
Row 1387644 (NC_000001.11:6107696::GGATGATGGAGAGATGGAGGAATAATAGAGGGATGATGGATGATGGAGAGATGGAGGGATGATGGAGGGATGAGGGATGAT 537/111764)...

- Apr 25, 2021 (155)
20 gnomAD - Genomes

Submission ignored due to conflicting rows:
Row 1387642 (NC_000001.11:6107696::GGATGATGGAGAGATGGAGGAATAATAGAGGGAGGAT 1/111804)
Row 1387643 (NC_000001.11:6107696::GGATGATGGAGAGATGGAGGAATAATAGAGGGATGAT 11264/111430)
Row 1387644 (NC_000001.11:6107696::GGATGATGGAGAGATGGAGGAATAATAGAGGGATGATGGATGATGGAGAGATGGAGGGATGATGGAGGGATGAGGGATGAT 537/111764)...

- Apr 25, 2021 (155)
21 gnomAD - Genomes

Submission ignored due to conflicting rows:
Row 1387642 (NC_000001.11:6107696::GGATGATGGAGAGATGGAGGAATAATAGAGGGAGGAT 1/111804)
Row 1387643 (NC_000001.11:6107696::GGATGATGGAGAGATGGAGGAATAATAGAGGGATGAT 11264/111430)
Row 1387644 (NC_000001.11:6107696::GGATGATGGAGAGATGGAGGAATAATAGAGGGATGATGGATGATGGAGAGATGGAGGGATGATGGAGGGATGAGGGATGAT 537/111764)...

- Apr 25, 2021 (155)
22 Korean Genome Project

Submission ignored due to conflicting rows:
Row 113554 (NC_000001.11:6107696::GGATGATGGAGAGATGGAGGAATAATAGAGGGATGAT 517/1828)
Row 113555 (NC_000001.11:6107696::GGATGATGGAGAGATGGAGGAATAATAGAGGGAGGAT 2/1828)

- Apr 25, 2020 (154)
23 Korean Genome Project

Submission ignored due to conflicting rows:
Row 113554 (NC_000001.11:6107696::GGATGATGGAGAGATGGAGGAATAATAGAGGGATGAT 517/1828)
Row 113555 (NC_000001.11:6107696::GGATGATGGAGAGATGGAGGAATAATAGAGGGAGGAT 2/1828)

- Apr 25, 2020 (154)
24 Northern Sweden NC_000001.10 - 6167757 Jul 12, 2019 (153)
25 8.3KJPN NC_000001.10 - 6167757 Apr 25, 2021 (155)
26 ALFA NC_000001.11 - 6107697 Apr 25, 2021 (155)
Help

History tab displays RefSNPs (Associated ID) from previous builds (Build) that now support the current RefSNP, and the dates, when the history was updated for each Associated ID (History Updated).

Added to this RefSNP Cluster:
Submission IDs Observation SPDI Canonical SPDI Source RSIDs
ss3686087152 NC_000001.11:6107696::GGATGATGGAGA…

NC_000001.11:6107696::GGATGATGGAGAGATGGAGGAATAAGAGAGGGAGGAT

NC_000001.11:6107696:GGATGATGGAGAG…

NC_000001.11:6107696:GGATGATGGAGAGATGGAGG:GGATGATGGAGAGATGGAGGAATAAGAGAGGGAGGATGGATGATGGAGAGATGGAGG

(self)
ss3943735554, ss3987672311 NC_000001.11:6107696::GGATGATGGAGA…

NC_000001.11:6107696::GGATGATGGAGAGATGGAGGAATAATAGAGGGAGGAT

NC_000001.11:6107696:GGATGATGGAGAG…

NC_000001.11:6107696:GGATGATGGAGAGATGGAGG:GGATGATGGAGAGATGGAGGAATAATAGAGGGAGGATGGATGATGGAGAGATGGAGG

(self)
43113, 259337, ss2137334792, ss3644052387, ss3726758248, ss3745566068, ss5142290030 NC_000001.10:6167756::GGATGATGGAGA…

NC_000001.10:6167756::GGATGATGGAGAGATGGAGGAATAATAGAGGGATGAT

NC_000001.11:6107696:GGATGATGGAGAG…

NC_000001.11:6107696:GGATGATGGAGAGATGGAGG:GGATGATGGAGAGATGGAGGAATAATAGAGGGATGATGGATGATGGAGAGATGGAGG

(self)
ss3686087154, ss3943735553, ss3987672312 NC_000001.11:6107696::GGATGATGGAGA…

NC_000001.11:6107696::GGATGATGGAGAGATGGAGGAATAATAGAGGGATGAT

NC_000001.11:6107696:GGATGATGGAGAG…

NC_000001.11:6107696:GGATGATGGAGAGATGGAGG:GGATGATGGAGAGATGGAGGAATAATAGAGGGATGATGGATGATGGAGAGATGGAGG

(self)
2103592700 NC_000001.11:6107696:GGATGATGGAGAG…

NC_000001.11:6107696:GGATGATGGAGAGATGGAGG:GGATGATGGAGAGATGGAGGAATAATAGAGGGATGATGGATGATGGAGAGATGGAGG

NC_000001.11:6107696:GGATGATGGAGAG…

NC_000001.11:6107696:GGATGATGGAGAGATGGAGG:GGATGATGGAGAGATGGAGGAATAATAGAGGGATGATGGATGATGGAGAGATGGAGG

ss3686087156 NC_000001.11:6107714::GGAATAATAGAG…

NC_000001.11:6107714::GGAATAATAGAGGGATGATGGATGATGGAGAGATGGA

NC_000001.11:6107696:GGATGATGGAGAG…

NC_000001.11:6107696:GGATGATGGAGAGATGGAGG:GGATGATGGAGAGATGGAGGAATAATAGAGGGATGATGGATGATGGAGAGATGGAGG

(self)
NC_000001.11:6107696::GGATGATGGAGA…

NC_000001.11:6107696::GGATGATGGAGAGATGGAGGAATAATAGAGGGATGATGGATGATGGAGAGATGGAGGGATGATGGAGGGATGAGGGATGAT

NC_000001.11:6107696:GGATGATGGAGAG…

NC_000001.11:6107696:GGATGATGGAGAGATGGAGG:GGATGATGGAGAGATGGAGGAATAATAGAGGGATGATGGATGATGGAGAGATGGAGGGATGATGGAGGGATGAGGGATGATGGATGATGGAGAGATGGAGG

2103592700 NC_000001.11:6107696:GGATGATGGAGAG…

NC_000001.11:6107696:GGATGATGGAGAGATGGAGG:GGATGATGGAGAGATGGAGGAATAATAGAGGGATGATGGATGATGGAGAGATGGAGGGATGATGGAGGGATGAGGGATGATGGATGATGGAGAGATGGAGG

NC_000001.11:6107696:GGATGATGGAGAG…

NC_000001.11:6107696:GGATGATGGAGAGATGGAGG:GGATGATGGAGAGATGGAGGAATAATAGAGGGATGATGGATGATGGAGAGATGGAGGGATGATGGAGGGATGAGGGATGATGGATGATGGAGAGATGGAGG

NC_000001.11:6107696::GGATGATGGAGA…

NC_000001.11:6107696::GGATGATGGAGAGATGGAGGAATAATAGAGGGATGATGGATGATGGAGAGATGGAGGGATGATTGAGGGATGAGGGATGAT

NC_000001.11:6107696:GGATGATGGAGAG…

NC_000001.11:6107696:GGATGATGGAGAGATGGAGG:GGATGATGGAGAGATGGAGGAATAATAGAGGGATGATGGATGATGGAGAGATGGAGGGATGATTGAGGGATGAGGGATGATGGATGATGGAGAGATGGAGG

ss3987672313 NC_000001.11:6107696::GGATGATGGAGA…

NC_000001.11:6107696::GGATGATGGAGAGATGGAGGAATAATAGAGGGTTGAT

NC_000001.11:6107696:GGATGATGGAGAG…

NC_000001.11:6107696:GGATGATGGAGAGATGGAGG:GGATGATGGAGAGATGGAGGAATAATAGAGGGTTGATGGATGATGGAGAGATGGAGG

ss3686087155 NC_000001.11:6107696::GGATGATGGAGA…

NC_000001.11:6107696::GGATGATGGAGAGATGGAGGAATAATGGAGGGATGAT

NC_000001.11:6107696:GGATGATGGAGAG…

NC_000001.11:6107696:GGATGATGGAGAGATGGAGG:GGATGATGGAGAGATGGAGGAATAATGGAGGGATGATGGATGATGGAGAGATGGAGG

(self)
ss3987672314 NC_000001.11:6107696::GGATGATGGAGA…

NC_000001.11:6107696::GGATGATGGAGAGATGGAGGAATAATTGAGGGATGAT

NC_000001.11:6107696:GGATGATGGAGAG…

NC_000001.11:6107696:GGATGATGGAGAGATGGAGG:GGATGATGGAGAGATGGAGGAATAATTGAGGGATGATGGATGATGGAGAGATGGAGG

Removed from this RefSNP Cluster:
Submission IDs Observation SPDI Canonical SPDI Destination RSIDs
NC_000001.10:6167756::GGATGATGGAGA…

NC_000001.10:6167756::GGATGATGGAGAGATGGAGGAATAATAGAGGGATGATGGATGATGGAGAGATGGAGGGATGATGGAGGGATGAGGGATGAT

NC_000001.11:6107696:GGATGATGGAGAG…

NC_000001.11:6107696:GGATGATGGAGAGATGGAGG:GGATGATGGAGAGATGGAGGAATAATAGAGGGATGATGGATGATGGAGAGATGGAGGGATGATGGAGGGATGAGGGATGATGGATGATGGAGAGATGGAGG

Help

Publications tab displays PubMed articles citing the variation as a listing of PMID, Title, Author, Year, Journal, ordered by Year, descending.

No publications for rs1396915301

Help

The Flanks tab provides retrieving flanking sequences of a SNP on all molecules that have placements.

Genome context:
Select flank length:

Genomic regions, transcripts, and products
Top Help

NCBI Graphical Sequence Viewer display of the genomic region, transcripts and protein products for the reported RefSNP (rs).
Use the zoom option to view the nucleotides around the RefSNP and find other neighboring RefSNPs.
Visit Sequence Viewer for help with navigating inside the display and modifying the selection of displayed data tracks.

Software version is: 2.0.1.post596+ae089ad