Skip to main page content
Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation

dbSNP Short Genetic Variations

Welcome to the Reference SNP (rs) Report

All alleles are reported in the Forward orientation. Click on the Variant Details tab for details on Genomic Placement, Gene, and Amino Acid changes. HGVS names are in the HGVS tab.

Reference SNP (rs) Report

This page reports data for a single dbSNP Reference SNP variation (RefSNP or rs) from the new redesigned dbSNP build.
Top of the page reports a concise summary for the rs, with more specific details included in the corresponding tabs below.
All alleles are reported in the Forward orientation. Use the Genomic View to inspect the nucleotides flanking the variant, and its neighbors.
For more information see Help documentation.

rs1452700552

Current Build 155

Released April 9, 2021

Organism
Homo sapiens
Position
chr1:15969007-15969025 (GRCh38.p13) Help

The anchor position for this RefSNP. Includes all nucleotides potentially affected by this change, thus it can differ from HGVS, which is right-shifted. See here for details.

Alleles
dupACGCAAGTGAGC
Variation Type
Indel Insertion and Deletion
Frequency
dupACGCAAGTGAGC=0.000004 (1/264690, TOPMED)
dupACGCAAGTGAGC=0.000007 (1/140274, GnomAD)
dupACGCAAGTGAGC=0.00000 (0/14050, ALFA)
Clinical Significance
Not Reported in ClinVar
Gene : Consequence
ZBTB17 : Intron Variant
Publications
0 citations
Genomic View
See rs on genome

ALFA Allele Frequency
The ALFA project provide aggregate allele frequency from dbGaP. More information is available on the project page including descriptions, data access, and terms of use.

Release Version: 20201027095038
Population Group Sample Size Ref Allele Alt Allele
Total Global 14050 AGTGAGCACGCAAGTGAGC=1.00000 AGTGAGCACGCAAGTGAGCACGCAAGTGAGC=0.00000
European Sub 9690 AGTGAGCACGCAAGTGAGC=1.0000 AGTGAGCACGCAAGTGAGCACGCAAGTGAGC=0.0000
African Sub 2898 AGTGAGCACGCAAGTGAGC=1.0000 AGTGAGCACGCAAGTGAGCACGCAAGTGAGC=0.0000
African Others Sub 114 AGTGAGCACGCAAGTGAGC=1.000 AGTGAGCACGCAAGTGAGCACGCAAGTGAGC=0.000
African American Sub 2784 AGTGAGCACGCAAGTGAGC=1.0000 AGTGAGCACGCAAGTGAGCACGCAAGTGAGC=0.0000
Asian Sub 112 AGTGAGCACGCAAGTGAGC=1.000 AGTGAGCACGCAAGTGAGCACGCAAGTGAGC=0.000
East Asian Sub 86 AGTGAGCACGCAAGTGAGC=1.00 AGTGAGCACGCAAGTGAGCACGCAAGTGAGC=0.00
Other Asian Sub 26 AGTGAGCACGCAAGTGAGC=1.00 AGTGAGCACGCAAGTGAGCACGCAAGTGAGC=0.00
Latin American 1 Sub 146 AGTGAGCACGCAAGTGAGC=1.000 AGTGAGCACGCAAGTGAGCACGCAAGTGAGC=0.000
Latin American 2 Sub 610 AGTGAGCACGCAAGTGAGC=1.000 AGTGAGCACGCAAGTGAGCACGCAAGTGAGC=0.000
South Asian Sub 98 AGTGAGCACGCAAGTGAGC=1.00 AGTGAGCACGCAAGTGAGCACGCAAGTGAGC=0.00
Other Sub 496 AGTGAGCACGCAAGTGAGC=1.000 AGTGAGCACGCAAGTGAGCACGCAAGTGAGC=0.000


Help

Frequency tab displays a table of the reference and alternate allele frequencies reported by various studies and populations. Table lines, where Population="Global" refer to the entire study population, whereas lines, where Group="Sub", refer to a study-specific population subgroupings (i.e. AFR, CAU, etc.), if available. Frequency for the alternate allele (Alt Allele) is a ratio of samples observed-to-total, where the numerator (observed samples) is the number of chromosomes in the study with the minor allele present (found in "Sample size", where Group="Sub"), and the denominator (total samples) is the total number of all chromosomes in the study for the variant (found in "Sample size", where Group="Study-wide" and Population="Global").

Download
Study Population Group Sample Size Ref Allele Alt Allele
TopMed Global Study-wide 264690 -

No frequency provided

dupACGCAAGTGAGC=0.000004
gnomAD - Genomes Global Study-wide 140274 -

No frequency provided

dupACGCAAGTGAGC=0.000007
gnomAD - Genomes European Sub 75958 -

No frequency provided

dupACGCAAGTGAGC=0.00000
gnomAD - Genomes African Sub 42044 -

No frequency provided

dupACGCAAGTGAGC=0.00000
gnomAD - Genomes American Sub 13662 -

No frequency provided

dupACGCAAGTGAGC=0.00000
gnomAD - Genomes Ashkenazi Jewish Sub 3322 -

No frequency provided

dupACGCAAGTGAGC=0.0000
gnomAD - Genomes East Asian Sub 3134 -

No frequency provided

dupACGCAAGTGAGC=0.0003
gnomAD - Genomes Other Sub 2154 -

No frequency provided

dupACGCAAGTGAGC=0.0000
Help

Variant Details tab shows known variant placements on genomic sequences: chromosomes (NC_), RefSeqGene, pseudogenes or genomic regions (NG_), and in a separate table: on transcripts (NM_) and protein sequences (NP_). The corresponding transcript and protein locations are listed in adjacent lines, along with molecular consequences from Sequence Ontology. When no protein placement is available, only the transcript is listed. Column "Codon[Amino acid]" shows the actual base change in the format of "Reference > Alternate" allele, including the nucleotide codon change in transcripts, and the amino acid change in proteins, respectively, allowing for known ribosomal slippage sites. To view nucleotides adjacent to the variant use the Genomic View at the bottom of the page - zoom into the sequence until the nucleotides around the variant become visible.

Genomic Placements
Sequence name Change
GRCh38.p13 chr 1 NC_000001.11:g.15969014_15969025dup
GRCh37.p13 chr 1 NC_000001.10:g.16295509_16295520dup
Gene: ZBTB17, zinc finger and BTB domain containing 17 (minus strand)
Molecule type Change Amino acid[Codon] SO Term
ZBTB17 transcript variant 1 NM_001242884.2:c.-64+4021…

NM_001242884.2:c.-64+4021_-64+4032dup

N/A Intron Variant
ZBTB17 transcript variant 3 NM_001287603.2:c.-3+4021_…

NM_001287603.2:c.-3+4021_-3+4032dup

N/A Intron Variant
ZBTB17 transcript variant 4 NM_001287604.2:c.-227+402…

NM_001287604.2:c.-227+4021_-227+4032dup

N/A Intron Variant
ZBTB17 transcript variant 5 NM_001324137.2:c.-24+4021…

NM_001324137.2:c.-24+4021_-24+4032dup

N/A Intron Variant
ZBTB17 transcript variant 6 NM_001324138.2:c.-3+4021_…

NM_001324138.2:c.-3+4021_-3+4032dup

N/A Intron Variant
ZBTB17 transcript variant 2 NM_003443.3:c.-3+4021_-3+…

NM_003443.3:c.-3+4021_-3+4032dup

N/A Intron Variant
ZBTB17 transcript variant X1 XM_005245986.2:c.-3+4021_…

XM_005245986.2:c.-3+4021_-3+4032dup

N/A Intron Variant
ZBTB17 transcript variant X2 XM_005245987.2:c.-227+402…

XM_005245987.2:c.-227+4021_-227+4032dup

N/A Intron Variant
ZBTB17 transcript variant X3 XM_011542085.3:c.-24+4021…

XM_011542085.3:c.-24+4021_-24+4032dup

N/A Intron Variant
ZBTB17 transcript variant X4 XM_011542086.2:c.-271+402…

XM_011542086.2:c.-271+4021_-271+4032dup

N/A Intron Variant
ZBTB17 transcript variant X5 XM_011542087.3:c.-64+4021…

XM_011542087.3:c.-64+4021_-64+4032dup

N/A Intron Variant
ZBTB17 transcript variant X7 XM_011542088.1:c.-271+402…

XM_011542088.1:c.-271+4021_-271+4032dup

N/A Intron Variant
ZBTB17 transcript variant X6 XM_017002242.2:c. N/A Genic Upstream Transcript Variant
ZBTB17 transcript variant X8 XR_001737399.1:n. N/A Intron Variant
Help

Clinical Significance tab shows a list of clinical significance entries from ClinVar associated with the variation, per allele. Click on the RCV accession (i.e. RCV000001615.2) or Allele ID (i.e. 12274) to access full ClinVar report.

Not Reported in ClinVar
Help

Aliases tab displays HGVS names representing the variant placements and allele changes on genomic, transcript and protein sequences, per allele. HGVS name is an expression for reporting sequence accession and version, sequence type, position, and allele change. The column "Note" can have two values: "diff" means that there is a difference between the reference allele (variation interval) at the placement reported in HGVS name and the reference alleles reported in other HGVS names, and "rev" means that the sequence of this variation interval at the placement reported in HGVS name is in reverse orientation to the sequence(s) of this variation in other HGVS names not labeled as "rev".

Placement AGTGAGCACGCAAGTGAGC= dupACGCAAGTGAGC
GRCh38.p13 chr 1 NC_000001.11:g.15969007_15969025= NC_000001.11:g.15969014_15969025dup
GRCh37.p13 chr 1 NC_000001.10:g.16295502_16295520= NC_000001.10:g.16295509_16295520dup
ZBTB17 transcript variant 1 NM_001242884.1:c.-64+4032= NM_001242884.1:c.-64+4021_-64+4032dup
ZBTB17 transcript variant 1 NM_001242884.2:c.-64+4032= NM_001242884.2:c.-64+4021_-64+4032dup
ZBTB17 transcript variant 3 NM_001287603.2:c.-3+4032= NM_001287603.2:c.-3+4021_-3+4032dup
ZBTB17 transcript variant 4 NM_001287604.2:c.-227+4032= NM_001287604.2:c.-227+4021_-227+4032dup
ZBTB17 transcript variant 5 NM_001324137.2:c.-24+4032= NM_001324137.2:c.-24+4021_-24+4032dup
ZBTB17 transcript variant 6 NM_001324138.2:c.-3+4032= NM_001324138.2:c.-3+4021_-3+4032dup
ZBTB17 transcript variant 2 NM_003443.2:c.-3+4032= NM_003443.2:c.-3+4021_-3+4032dup
ZBTB17 transcript variant 2 NM_003443.3:c.-3+4032= NM_003443.3:c.-3+4021_-3+4032dup
ZBTB17 transcript variant X1 XM_005245985.1:c.-3+4032= XM_005245985.1:c.-3+4021_-3+4032dup
ZBTB17 transcript variant X1 XM_005245986.1:c.-3+4032= XM_005245986.1:c.-3+4021_-3+4032dup
ZBTB17 transcript variant X1 XM_005245986.2:c.-3+4032= XM_005245986.2:c.-3+4021_-3+4032dup
ZBTB17 transcript variant X2 XM_005245987.1:c.-227+4032= XM_005245987.1:c.-227+4021_-227+4032dup
ZBTB17 transcript variant X2 XM_005245987.2:c.-227+4032= XM_005245987.2:c.-227+4021_-227+4032dup
ZBTB17 transcript variant X4 XM_005245988.1:c.-227+4032= XM_005245988.1:c.-227+4021_-227+4032dup
ZBTB17 transcript variant X5 XM_005245989.1:c.-3+4032= XM_005245989.1:c.-3+4021_-3+4032dup
ZBTB17 transcript variant X3 XM_011542085.3:c.-24+4032= XM_011542085.3:c.-24+4021_-24+4032dup
ZBTB17 transcript variant X4 XM_011542086.2:c.-271+4032= XM_011542086.2:c.-271+4021_-271+4032dup
ZBTB17 transcript variant X5 XM_011542087.3:c.-64+4032= XM_011542087.3:c.-64+4021_-64+4032dup
ZBTB17 transcript variant X7 XM_011542088.1:c.-271+4032= XM_011542088.1:c.-271+4021_-271+4032dup
Help

Submissions tab displays variations originally submitted to dbSNP, now supporting this RefSNP cluster (rs). We display Submitter handle, Submission identifier, Date and Build number, when the submission appeared for the first time. Direct submissions to dbSNP have Submission ID in the form of an ss-prefixed number (ss#). Other supporting variations are listed in the table without ss#.

4 SubSNP, 3 Frequency submissions
No Submitter Submission ID Date (Build)
1 SYSTEMSBIOZJU ss2137334799 Nov 08, 2017 (151)
2 TOPMED ss3069511263 Nov 08, 2017 (151)
3 GNOMAD ss3988926733 Apr 27, 2021 (155)
4 TOPMED ss4440351312 Apr 27, 2021 (155)
5 gnomAD - Genomes NC_000001.11 - 15969007 Apr 27, 2021 (155)
6 TopMed NC_000001.11 - 15969007 Apr 27, 2021 (155)
7 ALFA NC_000001.11 - 15969007 Apr 27, 2021 (155)
Help

History tab displays RefSNPs (Associated ID) from previous builds (Build) that now support the current RefSNP, and the dates, when the history was updated for each Associated ID (History Updated).

Added to this RefSNP Cluster:
Submission IDs Observation SPDI Canonical SPDI Source RSIDs
ss2137334799 NC_000001.10:16295501::AGTGAGCACGCA NC_000001.11:15969006:AGTGAGCACGCA…

NC_000001.11:15969006:AGTGAGCACGCAAGTGAGC:AGTGAGCACGCAAGTGAGCACGCAAGTGAGC

(self)
3485201, 2492701, 3957647, ss3069511263, ss3988926733, ss4440351312 NC_000001.11:15969006::AGTGAGCACGCA NC_000001.11:15969006:AGTGAGCACGCA…

NC_000001.11:15969006:AGTGAGCACGCAAGTGAGC:AGTGAGCACGCAAGTGAGCACGCAAGTGAGC

(self)
12982108589 NC_000001.11:15969006:AGTGAGCACGCA…

NC_000001.11:15969006:AGTGAGCACGCAAGTGAGC:AGTGAGCACGCAAGTGAGCACGCAAGTGAGC

NC_000001.11:15969006:AGTGAGCACGCA…

NC_000001.11:15969006:AGTGAGCACGCAAGTGAGC:AGTGAGCACGCAAGTGAGCACGCAAGTGAGC

(self)
Help

Publications tab displays PubMed articles citing the variation as a listing of PMID, Title, Author, Year, Journal, ordered by Year, descending.

No publications for rs1452700552

Help

The Flanks tab provides retrieving flanking sequences of a SNP on all molecules that have placements.

Genome context:
Select flank length:

Genomic regions, transcripts, and products
Top Help

NCBI Graphical Sequence Viewer display of the genomic region, transcripts and protein products for the reported RefSNP (rs).
Use the zoom option to view the nucleotides around the RefSNP and find other neighboring RefSNPs.
Visit Sequence Viewer for help with navigating inside the display and modifying the selection of displayed data tracks.

Software version is: 2.0.1.post629+eb05767