Skip to main page content
Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation

dbSNP Short Genetic Variations

Welcome to the Reference SNP (rs) Report

All alleles are reported in the Forward orientation. Click on the Variant Details tab for details on Genomic Placement, Gene, and Amino Acid changes. HGVS names are in the HGVS tab.

Reference SNP (rs) Report

This page reports data for a single dbSNP Reference SNP variation (RefSNP or rs) from the new redesigned dbSNP build.
Top of the page reports a concise summary for the rs, with more specific details included in the corresponding tabs below.
All alleles are reported in the Forward orientation. Use the Genomic View to inspect the nucleotides flanking the variant, and its neighbors.
For more information see Help documentation.

rs33910396

Current Build 155

Released April 9, 2021

Organism
Homo sapiens
Position
chr1:3042653 (GRCh38.p13) Help

The anchor position for this RefSNP. Includes all nucleotides potentially affected by this change, thus it can differ from HGVS, which is right-shifted. See here for details.

Alleles
dupG / ins(GCAC)2CACCACACCCGCATG(C…

dupG / ins(GCAC)2CACCACACCCGCATG(CAC)2CGCACCTGG / ins(GCAC)2CACCACACCC(GCATGCACCACCGCACCTG)2G / ins(GCAC)2CACCGCACCCACATG(CAC)2CGCACCTGG / ins(GCAC)2CACCGCACCCGCATG(CAC)2CGCACCTGG / ins(GCAC)2CACCGCACCC(GCATGCACCACCGCACCTG)2G / ins(GCAC)2CACCGCACCCGCATG(CAC)2TGCACCTGG / ins(GCAC)2CACCGCACCTG

Variation Type
Indel Insertion and Deletion
Frequency
ins(GCAC)2CACCGCACCCGCATG(CAC)2CGCACCTGG=0.13577 (2251/16580, 8.3KJPN)
dupG=0.0408 (389/9536, ALFA)
ins(GCAC)2CACCGCACCCGCATG(CAC)2CGCACCTGG=0.008 (5/600, NorthernSweden)
Clinical Significance
Not Reported in ClinVar
Gene : Consequence
None
Publications
0 citations
Genomic View
See rs on genome
Help

Variant Details tab shows known variant placements on genomic sequences: chromosomes (NC_), RefSeqGene, pseudogenes or genomic regions (NG_), and in a separate table: on transcripts (NM_) and protein sequences (NP_). The corresponding transcript and protein locations are listed in adjacent lines, along with molecular consequences from Sequence Ontology. When no protein placement is available, only the transcript is listed. Column "Codon[Amino acid]" shows the actual base change in the format of "Reference > Alternate" allele, including the nucleotide codon change in transcripts, and the amino acid change in proteins, respectively, allowing for known ribosomal slippage sites. To view nucleotides adjacent to the variant use the Genomic View at the bottom of the page - zoom into the sequence until the nucleotides around the variant become visible.

Genomic Placements
Sequence name Change
GRCh38.p13 chr 1 NC_000001.11:g.3042653dup
GRCh38.p13 chr 1 NC_000001.11:g.3042653_3042654insGCACGCACCACCACACCCGCATGCACCACCGCACCTGG
GRCh38.p13 chr 1 NC_000001.11:g.3042653_3042654insGCACGCACCACCACACCCGCATGCACCACCGCACCTGGCATGCACCACCGCACCTGG
GRCh38.p13 chr 1 NC_000001.11:g.3042653_3042654insGCACGCACCACCGCACCCACATGCACCACCGCACCTGG
GRCh38.p13 chr 1 NC_000001.11:g.3042653_3042654insGCACGCACCACCGCACCCGCATGCACCACCGCACCTGG
GRCh38.p13 chr 1 NC_000001.11:g.3042653_3042654insGCACGCACCACCGCACCCGCATGCACCACCGCACCTGGCATGCACCACCGCACCTGG
GRCh38.p13 chr 1 NC_000001.11:g.3042653_3042654insGCACGCACCACCGCACCCGCATGCACCACTGCACCTGG
GRCh38.p13 chr 1 NC_000001.11:g.3042653_3042654insGCACGCACCACCGCACCTG
GRCh37.p13 chr 1 NC_000001.10:g.2959217dup
GRCh37.p13 chr 1 NC_000001.10:g.2959217_2959218insGCACGCACCACCACACCCGCATGCACCACCGCACCTGG
GRCh37.p13 chr 1 NC_000001.10:g.2959217_2959218insGCACGCACCACCACACCCGCATGCACCACCGCACCTGGCATGCACCACCGCACCTGG
GRCh37.p13 chr 1 NC_000001.10:g.2959217_2959218insGCACGCACCACCGCACCCACATGCACCACCGCACCTGG
GRCh37.p13 chr 1 NC_000001.10:g.2959217_2959218insGCACGCACCACCGCACCCGCATGCACCACCGCACCTGG
GRCh37.p13 chr 1 NC_000001.10:g.2959217_2959218insGCACGCACCACCGCACCCGCATGCACCACCGCACCTGGCATGCACCACCGCACCTGG
GRCh37.p13 chr 1 NC_000001.10:g.2959217_2959218insGCACGCACCACCGCACCCGCATGCACCACTGCACCTGG
GRCh37.p13 chr 1 NC_000001.10:g.2959217_2959218insGCACGCACCACCGCACCTG
Help

Clinical Significance tab shows a list of clinical significance entries from ClinVar associated with the variation, per allele. Click on the RCV accession (i.e. RCV000001615.2) or Allele ID (i.e. 12274) to access full ClinVar report.

Not Reported in ClinVar

ALFA Allele Frequency
The ALFA project provide aggregate allele frequency from dbGaP. More information is available on the project page including descriptions, data access, and terms of use.

Release Version: 20201027095038
Population Group Sample Size Ref Allele Alt Allele
Total Global 9536 G=0.9566 GG=0.0408, GGCACGCACCACCGCACCCGCATGCACCACCGCACCTGG=0.0025, GGCACGCACCACCACACCCGCATGCACCACCGCACCTGGCATGCACCACCGCACCTGG=0.0001
European Sub 8228 G=0.9750 GG=0.0220, GGCACGCACCACCGCACCCGCATGCACCACCGCACCTGG=0.0029, GGCACGCACCACCACACCCGCATGCACCACCGCACCTGGCATGCACCACCGCACCTGG=0.0001
African Sub 944 G=0.782 GG=0.218, GGCACGCACCACCGCACCCGCATGCACCACCGCACCTGG=0.000, GGCACGCACCACCACACCCGCATGCACCACCGCACCTGGCATGCACCACCGCACCTGG=0.000
African Others Sub 34 G=0.74 GG=0.26, GGCACGCACCACCGCACCCGCATGCACCACCGCACCTGG=0.00, GGCACGCACCACCACACCCGCATGCACCACCGCACCTGGCATGCACCACCGCACCTGG=0.00
African American Sub 910 G=0.784 GG=0.216, GGCACGCACCACCGCACCCGCATGCACCACCGCACCTGG=0.000, GGCACGCACCACCACACCCGCATGCACCACCGCACCTGGCATGCACCACCGCACCTGG=0.000
Asian Sub 16 G=1.00 GG=0.00, GGCACGCACCACCGCACCCGCATGCACCACCGCACCTGG=0.00, GGCACGCACCACCACACCCGCATGCACCACCGCACCTGGCATGCACCACCGCACCTGG=0.00
East Asian Sub 12 G=1.00 GG=0.00, GGCACGCACCACCGCACCCGCATGCACCACCGCACCTGG=0.00, GGCACGCACCACCACACCCGCATGCACCACCGCACCTGGCATGCACCACCGCACCTGG=0.00
Other Asian Sub 4 G=1.0 GG=0.0, GGCACGCACCACCGCACCCGCATGCACCACCGCACCTGG=0.0, GGCACGCACCACCACACCCGCATGCACCACCGCACCTGGCATGCACCACCGCACCTGG=0.0
Latin American 1 Sub 44 G=1.00 GG=0.00, GGCACGCACCACCGCACCCGCATGCACCACCGCACCTGG=0.00, GGCACGCACCACCACACCCGCATGCACCACCGCACCTGGCATGCACCACCGCACCTGG=0.00
Latin American 2 Sub 128 G=1.000 GG=0.000, GGCACGCACCACCGCACCCGCATGCACCACCGCACCTGG=0.000, GGCACGCACCACCACACCCGCATGCACCACCGCACCTGGCATGCACCACCGCACCTGG=0.000
South Asian Sub 34 G=1.00 GG=0.00, GGCACGCACCACCGCACCCGCATGCACCACCGCACCTGG=0.00, GGCACGCACCACCACACCCGCATGCACCACCGCACCTGGCATGCACCACCGCACCTGG=0.00
Other Sub 142 G=0.986 GG=0.014, GGCACGCACCACCGCACCCGCATGCACCACCGCACCTGG=0.000, GGCACGCACCACCACACCCGCATGCACCACCGCACCTGGCATGCACCACCGCACCTGG=0.000


Help

Frequency tab displays a table of the reference and alternate allele frequencies reported by various studies and populations. Table lines, where Population="Global" refer to the entire study population, whereas lines, where Group="Sub", refer to a study-specific population subgroupings (i.e. AFR, CAU, etc.), if available. Frequency for the alternate allele (Alt Allele) is a ratio of samples observed-to-total, where the numerator (observed samples) is the number of chromosomes in the study with the minor allele present (found in "Sample size", where Group="Sub"), and the denominator (total samples) is the total number of all chromosomes in the study for the variant (found in "Sample size", where Group="Study-wide" and Population="Global").

Download
Study Population Group Sample Size Ref Allele Alt Allele
8.3KJPN JAPANESE Study-wide 16580 -

No frequency provided

ins(GCAC)2CACCGCACCCGCATG(CAC)2CGCACCTGG=0.13577
Northern Sweden ACPOP Study-wide 600 -

No frequency provided

ins(GCAC)2CACCGCACCCGCATG(CAC)2CGCACCTGG=0.008
Help

Aliases tab displays HGVS names representing the variant placements and allele changes on genomic, transcript and protein sequences, per allele. HGVS name is an expression for reporting sequence accession and version, sequence type, position, and allele change. The column "Note" can have two values: "diff" means that there is a difference between the reference allele (variation interval) at the placement reported in HGVS name and the reference alleles reported in other HGVS names, and "rev" means that the sequence of this variation interval at the placement reported in HGVS name is in reverse orientation to the sequence(s) of this variation in other HGVS names not labeled as "rev".

Placement G= dupG ins(GCAC)2CACCACACCCGCATG(CAC)2CGCACCTGG ins(GCAC)2CACCACACCC(GCATGCACCACCGCACCTG)2G ins(GCAC)2CACCGCACCCACATG(CAC)2CGCACCTGG ins(GCAC)2CACCGCACCCGCATG(CAC)2CGCACCTGG ins(GCAC)2CACCGCACCC(GCATGCACCACCGCACCTG)2G ins(GCAC)2CACCGCACCCGCATG(CAC)2TGCACCTGG ins(GCAC)2CACCGCACCTG
GRCh38.p13 chr 1 NC_000001.11:g.3042653= NC_000001.11:g.3042653dup NC_000001.11:g.3042653_3042654insGCACGCACCACCACACCCGCATGCACCACCGCACCTGG NC_000001.11:g.3042653_3042654insGCACGCACCACCACACCCGCATGCACCACCGCACCTGGCATGCACCACCGCACCTGG NC_000001.11:g.3042653_3042654insGCACGCACCACCGCACCCACATGCACCACCGCACCTGG NC_000001.11:g.3042653_3042654insGCACGCACCACCGCACCCGCATGCACCACCGCACCTGG NC_000001.11:g.3042653_3042654insGCACGCACCACCGCACCCGCATGCACCACCGCACCTGGCATGCACCACCGCACCTGG NC_000001.11:g.3042653_3042654insGCACGCACCACCGCACCCGCATGCACCACTGCACCTGG NC_000001.11:g.3042653_3042654insGCACGCACCACCGCACCTG
GRCh37.p13 chr 1 NC_000001.10:g.2959217= NC_000001.10:g.2959217dup NC_000001.10:g.2959217_2959218insGCACGCACCACCACACCCGCATGCACCACCGCACCTGG NC_000001.10:g.2959217_2959218insGCACGCACCACCACACCCGCATGCACCACCGCACCTGGCATGCACCACCGCACCTGG NC_000001.10:g.2959217_2959218insGCACGCACCACCGCACCCACATGCACCACCGCACCTGG NC_000001.10:g.2959217_2959218insGCACGCACCACCGCACCCGCATGCACCACCGCACCTGG NC_000001.10:g.2959217_2959218insGCACGCACCACCGCACCCGCATGCACCACCGCACCTGGCATGCACCACCGCACCTGG NC_000001.10:g.2959217_2959218insGCACGCACCACCGCACCCGCATGCACCACTGCACCTGG NC_000001.10:g.2959217_2959218insGCACGCACCACCGCACCTG
Help

Submissions tab displays variations originally submitted to dbSNP, now supporting this RefSNP cluster (rs). We display Submitter handle, Submission identifier, Date and Build number, when the submission appeared for the first time. Direct submissions to dbSNP have Submission ID in the form of an ss-prefixed number (ss#). Other supporting variations are listed in the table without ss#.

23 SubSNP, 14 Frequency submissions
No Submitter Submission ID Date (Build)
1 1000GENOMES ss325998113 May 09, 2011 (138)
2 1000GENOMES ss325998869 May 09, 2011 (138)
3 1000GENOMES ss325999087 May 09, 2011 (138)
4 LUNTER ss550899920 Apr 25, 2013 (138)
5 LUNTER ss550904151 Apr 25, 2013 (138)
6 LUNTER ss552740178 Apr 25, 2013 (138)
7 SSMP ss663180000 Apr 01, 2015 (144)
8 BILGI_BIOE ss666080409 Apr 25, 2013 (138)
9 SYSTEMSBIOZJU ss2137334784 Nov 08, 2017 (151)
10 SWEGEN ss2986189741 Nov 08, 2017 (151)
11 MCHAISSO ss3065283428 Nov 08, 2017 (151)
12 TOPMED ss3066953724 Nov 08, 2017 (151)
13 ACPOP ss3726733478 Jul 12, 2019 (153)
14 KOGIC ss3943675591 Apr 25, 2020 (154)
15 KOGIC ss3943675592 Apr 25, 2020 (154)
16 KOGIC ss3943675593 Apr 25, 2020 (154)
17 GNOMAD ss3987264892 Apr 25, 2021 (155)
18 GNOMAD ss3987264894 Apr 25, 2021 (155)
19 GNOMAD ss3987264895 Apr 25, 2021 (155)
20 GNOMAD ss3987264896 Apr 25, 2021 (155)
21 GNOMAD ss3987264897 Apr 25, 2021 (155)
22 GNOMAD ss3987264898 Apr 25, 2021 (155)
23 TOMMO_GENOMICS ss5142167903 Apr 25, 2021 (155)
24 gnomAD - Genomes

Submission ignored due to conflicting rows:
Row 671119 (NC_000001.11:3042652::G 132/63294)
Row 671121 (NC_000001.11:3042652::GGCACGCACCACCACACCCGCATGCACCACCGCACCTG 24/63334)
Row 671122 (NC_000001.11:3042652::GGCACGCACCACCACACCCGCATGCACCACCGCACCTGGCATGCACCACCGCACCTG 18/63340)...

- Apr 25, 2021 (155)
25 gnomAD - Genomes

Submission ignored due to conflicting rows:
Row 671119 (NC_000001.11:3042652::G 132/63294)
Row 671121 (NC_000001.11:3042652::GGCACGCACCACCACACCCGCATGCACCACCGCACCTG 24/63334)
Row 671122 (NC_000001.11:3042652::GGCACGCACCACCACACCCGCATGCACCACCGCACCTGGCATGCACCACCGCACCTG 18/63340)...

- Apr 25, 2021 (155)
26 gnomAD - Genomes

Submission ignored due to conflicting rows:
Row 671119 (NC_000001.11:3042652::G 132/63294)
Row 671121 (NC_000001.11:3042652::GGCACGCACCACCACACCCGCATGCACCACCGCACCTG 24/63334)
Row 671122 (NC_000001.11:3042652::GGCACGCACCACCACACCCGCATGCACCACCGCACCTGGCATGCACCACCGCACCTG 18/63340)...

- Apr 25, 2021 (155)
27 gnomAD - Genomes

Submission ignored due to conflicting rows:
Row 671119 (NC_000001.11:3042652::G 132/63294)
Row 671121 (NC_000001.11:3042652::GGCACGCACCACCACACCCGCATGCACCACCGCACCTG 24/63334)
Row 671122 (NC_000001.11:3042652::GGCACGCACCACCACACCCGCATGCACCACCGCACCTGGCATGCACCACCGCACCTG 18/63340)...

- Apr 25, 2021 (155)
28 gnomAD - Genomes

Submission ignored due to conflicting rows:
Row 671119 (NC_000001.11:3042652::G 132/63294)
Row 671121 (NC_000001.11:3042652::GGCACGCACCACCACACCCGCATGCACCACCGCACCTG 24/63334)
Row 671122 (NC_000001.11:3042652::GGCACGCACCACCACACCCGCATGCACCACCGCACCTGGCATGCACCACCGCACCTG 18/63340)...

- Apr 25, 2021 (155)
29 gnomAD - Genomes

Submission ignored due to conflicting rows:
Row 671119 (NC_000001.11:3042652::G 132/63294)
Row 671121 (NC_000001.11:3042652::GGCACGCACCACCACACCCGCATGCACCACCGCACCTG 24/63334)
Row 671122 (NC_000001.11:3042652::GGCACGCACCACCACACCCGCATGCACCACCGCACCTGGCATGCACCACCGCACCTG 18/63340)...

- Apr 25, 2021 (155)
30 gnomAD - Genomes

Submission ignored due to conflicting rows:
Row 671119 (NC_000001.11:3042652::G 132/63294)
Row 671121 (NC_000001.11:3042652::GGCACGCACCACCACACCCGCATGCACCACCGCACCTG 24/63334)
Row 671122 (NC_000001.11:3042652::GGCACGCACCACCACACCCGCATGCACCACCGCACCTGGCATGCACCACCGCACCTG 18/63340)...

- Apr 25, 2021 (155)
31 gnomAD - Genomes

Submission ignored due to conflicting rows:
Row 671119 (NC_000001.11:3042652::G 132/63294)
Row 671121 (NC_000001.11:3042652::GGCACGCACCACCACACCCGCATGCACCACCGCACCTG 24/63334)
Row 671122 (NC_000001.11:3042652::GGCACGCACCACCACACCCGCATGCACCACCGCACCTGGCATGCACCACCGCACCTG 18/63340)...

- Apr 25, 2021 (155)
32 Korean Genome Project

Submission ignored due to conflicting rows:
Row 53592 (NC_000001.11:3042652::GGCACGCACCACCGCACCCGCATGCACCACCGCACCTG 240/1824)
Row 53593 (NC_000001.11:3042652::G 3/1824)
Row 53594 (NC_000001.11:3042652::GGCACGCACCACCGCACCCACATGCACCACCGCACCTG 1/1824)

- Apr 25, 2020 (154)
33 Korean Genome Project

Submission ignored due to conflicting rows:
Row 53592 (NC_000001.11:3042652::GGCACGCACCACCGCACCCGCATGCACCACCGCACCTG 240/1824)
Row 53593 (NC_000001.11:3042652::G 3/1824)
Row 53594 (NC_000001.11:3042652::GGCACGCACCACCGCACCCACATGCACCACCGCACCTG 1/1824)

- Apr 25, 2020 (154)
34 Korean Genome Project

Submission ignored due to conflicting rows:
Row 53592 (NC_000001.11:3042652::GGCACGCACCACCGCACCCGCATGCACCACCGCACCTG 240/1824)
Row 53593 (NC_000001.11:3042652::G 3/1824)
Row 53594 (NC_000001.11:3042652::GGCACGCACCACCGCACCCACATGCACCACCGCACCTG 1/1824)

- Apr 25, 2020 (154)
35 Northern Sweden NC_000001.10 - 2959217 Jul 12, 2019 (153)
36 8.3KJPN NC_000001.10 - 2959217 Apr 25, 2021 (155)
37 ALFA NC_000001.11 - 3042653 Apr 25, 2021 (155)
Help

History tab displays RefSNPs (Associated ID) from previous builds (Build) that now support the current RefSNP, and the dates, when the history was updated for each Associated ID (History Updated).

Associated ID History Updated (Build)
rs140410548 May 15, 2013 (138)
Added to this RefSNP Cluster:
Submission IDs Observation SPDI Canonical SPDI Source RSIDs
ss325998113, ss325998869, ss325999087, ss550899920, ss550904151, ss552740178 NC_000001.9:2949076::G NC_000001.11:3042652:G:GG (self)
ss663180000, ss666080409 NC_000001.10:2959216::G NC_000001.11:3042652:G:GG (self)
ss3066953724, ss3943675592, ss3987264892 NC_000001.11:3042652::G NC_000001.11:3042652:G:GG (self)
12500603270 NC_000001.11:3042652:G:GG NC_000001.11:3042652:G:GG
ss3987264894 NC_000001.11:3042652::GGCACGCACCAC…

NC_000001.11:3042652::GGCACGCACCACCACACCCGCATGCACCACCGCACCTG

NC_000001.11:3042652:G:GGCACGCACCA…

NC_000001.11:3042652:G:GGCACGCACCACCACACCCGCATGCACCACCGCACCTGG

NC_000001.11:3042652::GGCACGCACCAC…

NC_000001.11:3042652::GGCACGCACCACCACACCCGCATGCACCACCGCACCTGGCATGCACCACCGCACCTG

NC_000001.11:3042652:G:GGCACGCACCA…

NC_000001.11:3042652:G:GGCACGCACCACCACACCCGCATGCACCACCGCACCTGGCATGCACCACCGCACCTGG

12500603270 NC_000001.11:3042652:G:GGCACGCACCA…

NC_000001.11:3042652:G:GGCACGCACCACCACACCCGCATGCACCACCGCACCTGGCATGCACCACCGCACCTGG

NC_000001.11:3042652:G:GGCACGCACCA…

NC_000001.11:3042652:G:GGCACGCACCACCACACCCGCATGCACCACCGCACCTGGCATGCACCACCGCACCTGG

ss3943675593, ss3987264895 NC_000001.11:3042652::GGCACGCACCAC…

NC_000001.11:3042652::GGCACGCACCACCGCACCCACATGCACCACCGCACCTG

NC_000001.11:3042652:G:GGCACGCACCA…

NC_000001.11:3042652:G:GGCACGCACCACCGCACCCACATGCACCACCGCACCTGG

(self)
18343, 137210, ss2137334784, ss2986189741, ss3726733478, ss5142167903 NC_000001.10:2959216::GGCACGCACCAC…

NC_000001.10:2959216::GGCACGCACCACCGCACCCGCATGCACCACCGCACCTG

NC_000001.11:3042652:G:GGCACGCACCA…

NC_000001.11:3042652:G:GGCACGCACCACCGCACCCGCATGCACCACCGCACCTGG

(self)
ss3065283428, ss3943675591, ss3987264896 NC_000001.11:3042652::GGCACGCACCAC…

NC_000001.11:3042652::GGCACGCACCACCGCACCCGCATGCACCACCGCACCTG

NC_000001.11:3042652:G:GGCACGCACCA…

NC_000001.11:3042652:G:GGCACGCACCACCGCACCCGCATGCACCACCGCACCTGG

(self)
12500603270 NC_000001.11:3042652:G:GGCACGCACCA…

NC_000001.11:3042652:G:GGCACGCACCACCGCACCCGCATGCACCACCGCACCTGG

NC_000001.11:3042652:G:GGCACGCACCA…

NC_000001.11:3042652:G:GGCACGCACCACCGCACCCGCATGCACCACCGCACCTGG

NC_000001.11:3042652::GGCACGCACCAC…

NC_000001.11:3042652::GGCACGCACCACCGCACCCGCATGCACCACCGCACCTGGCATGCACCACCGCACCTG

NC_000001.11:3042652:G:GGCACGCACCA…

NC_000001.11:3042652:G:GGCACGCACCACCGCACCCGCATGCACCACCGCACCTGGCATGCACCACCGCACCTGG

ss3987264897 NC_000001.11:3042652::GGCACGCACCAC…

NC_000001.11:3042652::GGCACGCACCACCGCACCCGCATGCACCACTGCACCTG

NC_000001.11:3042652:G:GGCACGCACCA…

NC_000001.11:3042652:G:GGCACGCACCACCGCACCCGCATGCACCACTGCACCTGG

ss3987264898 NC_000001.11:3042652::GGCACGCACCAC…

NC_000001.11:3042652::GGCACGCACCACCGCACCT

NC_000001.11:3042652:G:GGCACGCACCA…

NC_000001.11:3042652:G:GGCACGCACCACCGCACCTG

Help

Publications tab displays PubMed articles citing the variation as a listing of PMID, Title, Author, Year, Journal, ordered by Year, descending.

No publications for rs33910396

Help

The Flanks tab provides retrieving flanking sequences of a SNP on all molecules that have placements.

Genome context:
Select flank length:

Genomic regions, transcripts, and products
Top Help

NCBI Graphical Sequence Viewer display of the genomic region, transcripts and protein products for the reported RefSNP (rs).
Use the zoom option to view the nucleotides around the RefSNP and find other neighboring RefSNPs.
Visit Sequence Viewer for help with navigating inside the display and modifying the selection of displayed data tracks.

Software version is: 2.0.1.post596+ae089ad