Skip to main page content
Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation

dbSNP Short Genetic Variations

Welcome to the Reference SNP (rs) Report

All alleles are reported in the Forward orientation. Click on the Variant Details tab for details on Genomic Placement, Gene, and Amino Acid changes. HGVS names are in the HGVS tab.

Reference SNP (rs) Report

This page reports data for a single dbSNP Reference SNP variation (RefSNP or rs) from the new redesigned dbSNP build.
Top of the page reports a concise summary for the rs, with more specific details included in the corresponding tabs below.
All alleles are reported in the Forward orientation. Use the Genomic View to inspect the nucleotides flanking the variant, and its neighbors.
For more information see Help documentation.

rs370960470

Current Build 155

Released April 9, 2021

Organism
Homo sapiens
Position
chr10:286509-286540 (GRCh38.p13) Help

The anchor position for this RefSNP. Includes all nucleotides potentially affected by this change, thus it can differ from HGVS, which is right-shifted. See here for details.

Alleles
delGCCTCACAATCACA / dupGCCTCACAATC…

delGCCTCACAATCACA / dupGCCTCACAATCACA

Variation Type
Indel Insertion and Deletion
Frequency
delGCCTCACAATCACA=0.001273 (337/264690, TOPMED)
delGCCTCACAATCACA=0.001375 (192/139650, GnomAD)
delGCCTCACAATCACA=0.00006 (1/16760, 8.3KJPN) (+ 1 more)
delGCCTCACAATCACA=0.00021 (3/14030, ALFA)
Clinical Significance
Not Reported in ClinVar
Gene : Consequence
DIP2C : Intron Variant
Publications
0 citations
Genomic View
See rs on genome
Help

Variant Details tab shows known variant placements on genomic sequences: chromosomes (NC_), RefSeqGene, pseudogenes or genomic regions (NG_), and in a separate table: on transcripts (NM_) and protein sequences (NP_). The corresponding transcript and protein locations are listed in adjacent lines, along with molecular consequences from Sequence Ontology. When no protein placement is available, only the transcript is listed. Column "Codon[Amino acid]" shows the actual base change in the format of "Reference > Alternate" allele, including the nucleotide codon change in transcripts, and the amino acid change in proteins, respectively, allowing for known ribosomal slippage sites. To view nucleotides adjacent to the variant use the Genomic View at the bottom of the page - zoom into the sequence until the nucleotides around the variant become visible.

Genomic Placements
Sequence name Change
GRCh38.p13 chr 10 NC_000010.11:g.286513GCCTCACAATCACA[1]
GRCh38.p13 chr 10 NC_000010.11:g.286513GCCTCACAATCACA[3]
GRCh37.p13 chr 10 NC_000010.10:g.332453GCCTCACAATCACA[1]
GRCh37.p13 chr 10 NC_000010.10:g.332453GCCTCACAATCACA[3]
Gene: DIP2C, disco interacting protein 2 homolog C (minus strand)
Molecule type Change Amino acid[Codon] SO Term
DIP2C transcript NM_014974.3:c.4045-175_40…

NM_014974.3:c.4045-175_4045-162del

N/A Intron Variant
DIP2C transcript variant X4 XM_005252426.3:c.4213-175…

XM_005252426.3:c.4213-175_4213-162del

N/A Intron Variant
DIP2C transcript variant X6 XM_005252427.4:c.4075-175…

XM_005252427.4:c.4075-175_4075-162del

N/A Intron Variant
DIP2C transcript variant X2 XM_005252428.4:c.4243-175…

XM_005252428.4:c.4243-175_4243-162del

N/A Intron Variant
DIP2C transcript variant X10 XM_005252430.3:c.2356-175…

XM_005252430.3:c.2356-175_2356-162del

N/A Intron Variant
DIP2C transcript variant X1 XM_011519428.3:c.4255-175…

XM_011519428.3:c.4255-175_4255-162del

N/A Intron Variant
DIP2C transcript variant X3 XM_011519429.3:c.4225-175…

XM_011519429.3:c.4225-175_4225-162del

N/A Intron Variant
DIP2C transcript variant X5 XM_011519430.2:c.4087-175…

XM_011519430.2:c.4087-175_4087-162del

N/A Intron Variant
DIP2C transcript variant X7 XM_011519431.2:c.4057-175…

XM_011519431.2:c.4057-175_4057-162del

N/A Intron Variant
DIP2C transcript variant X8 XM_011519432.2:c.3754-175…

XM_011519432.2:c.3754-175_3754-162del

N/A Intron Variant
DIP2C transcript variant X11 XM_011519433.3:c.2038-175…

XM_011519433.3:c.2038-175_2038-162del

N/A Intron Variant
DIP2C transcript variant X9 XM_017015977.1:c.2386-175…

XM_017015977.1:c.2386-175_2386-162del

N/A Intron Variant
Help

Clinical Significance tab shows a list of clinical significance entries from ClinVar associated with the variation, per allele. Click on the RCV accession (i.e. RCV000001615.2) or Allele ID (i.e. 12274) to access full ClinVar report.

Not Reported in ClinVar

ALFA Allele Frequency
The ALFA project provide aggregate allele frequency from dbGaP. More information is available on the project page including descriptions, data access, and terms of use.

Release Version: 20201027095038
Population Group Sample Size Ref Allele Alt Allele
Total Global 14030 CACAGCCTCACAATCACAGCCTCACAATCACA=0.99979 CACAGCCTCACAATCACA=0.00021, CACAGCCTCACAATCACAGCCTCACAATCACAGCCTCACAATCACA=0.00000
European Sub 9688 CACAGCCTCACAATCACAGCCTCACAATCACA=1.0000 CACAGCCTCACAATCACA=0.0000, CACAGCCTCACAATCACAGCCTCACAATCACAGCCTCACAATCACA=0.0000
African Sub 2882 CACAGCCTCACAATCACAGCCTCACAATCACA=0.9990 CACAGCCTCACAATCACA=0.0010, CACAGCCTCACAATCACAGCCTCACAATCACAGCCTCACAATCACA=0.0000
African Others Sub 114 CACAGCCTCACAATCACAGCCTCACAATCACA=1.000 CACAGCCTCACAATCACA=0.000, CACAGCCTCACAATCACAGCCTCACAATCACAGCCTCACAATCACA=0.000
African American Sub 2768 CACAGCCTCACAATCACAGCCTCACAATCACA=0.9989 CACAGCCTCACAATCACA=0.0011, CACAGCCTCACAATCACAGCCTCACAATCACAGCCTCACAATCACA=0.0000
Asian Sub 112 CACAGCCTCACAATCACAGCCTCACAATCACA=1.000 CACAGCCTCACAATCACA=0.000, CACAGCCTCACAATCACAGCCTCACAATCACAGCCTCACAATCACA=0.000
East Asian Sub 86 CACAGCCTCACAATCACAGCCTCACAATCACA=1.00 CACAGCCTCACAATCACA=0.00, CACAGCCTCACAATCACAGCCTCACAATCACAGCCTCACAATCACA=0.00
Other Asian Sub 26 CACAGCCTCACAATCACAGCCTCACAATCACA=1.00 CACAGCCTCACAATCACA=0.00, CACAGCCTCACAATCACAGCCTCACAATCACAGCCTCACAATCACA=0.00
Latin American 1 Sub 146 CACAGCCTCACAATCACAGCCTCACAATCACA=1.000 CACAGCCTCACAATCACA=0.000, CACAGCCTCACAATCACAGCCTCACAATCACAGCCTCACAATCACA=0.000
Latin American 2 Sub 608 CACAGCCTCACAATCACAGCCTCACAATCACA=1.000 CACAGCCTCACAATCACA=0.000, CACAGCCTCACAATCACAGCCTCACAATCACAGCCTCACAATCACA=0.000
South Asian Sub 98 CACAGCCTCACAATCACAGCCTCACAATCACA=1.00 CACAGCCTCACAATCACA=0.00, CACAGCCTCACAATCACAGCCTCACAATCACAGCCTCACAATCACA=0.00
Other Sub 496 CACAGCCTCACAATCACAGCCTCACAATCACA=1.000 CACAGCCTCACAATCACA=0.000, CACAGCCTCACAATCACAGCCTCACAATCACAGCCTCACAATCACA=0.000


Help

Frequency tab displays a table of the reference and alternate allele frequencies reported by various studies and populations. Table lines, where Population="Global" refer to the entire study population, whereas lines, where Group="Sub", refer to a study-specific population subgroupings (i.e. AFR, CAU, etc.), if available. Frequency for the alternate allele (Alt Allele) is a ratio of samples observed-to-total, where the numerator (observed samples) is the number of chromosomes in the study with the minor allele present (found in "Sample size", where Group="Sub"), and the denominator (total samples) is the total number of all chromosomes in the study for the variant (found in "Sample size", where Group="Study-wide" and Population="Global").

Download
Study Population Group Sample Size Ref Allele Alt Allele
TopMed Global Study-wide 264690 (CACAGCCTCACAAT)2CACA=0.998727 delGCCTCACAATCACA=0.001273
gnomAD - Genomes Global Study-wide 139650 (CACAGCCTCACAAT)2CACA=0.998625 delGCCTCACAATCACA=0.001375
gnomAD - Genomes European Sub 75920 (CACAGCCTCACAAT)2CACA=0.99988 delGCCTCACAATCACA=0.00012
gnomAD - Genomes African Sub 41584 (CACAGCCTCACAAT)2CACA=0.99577 delGCCTCACAATCACA=0.00423
gnomAD - Genomes American Sub 13642 (CACAGCCTCACAAT)2CACA=0.99956 delGCCTCACAATCACA=0.00044
gnomAD - Genomes Ashkenazi Jewish Sub 3226 (CACAGCCTCACAAT)2CACA=1.0000 delGCCTCACAATCACA=0.0000
gnomAD - Genomes East Asian Sub 3130 (CACAGCCTCACAAT)2CACA=1.0000 delGCCTCACAATCACA=0.0000
gnomAD - Genomes Other Sub 2148 (CACAGCCTCACAAT)2CACA=0.9995 delGCCTCACAATCACA=0.0005
8.3KJPN JAPANESE Study-wide 16760 (CACAGCCTCACAAT)2CACA=0.99994 delGCCTCACAATCACA=0.00006
Help

Aliases tab displays HGVS names representing the variant placements and allele changes on genomic, transcript and protein sequences, per allele. HGVS name is an expression for reporting sequence accession and version, sequence type, position, and allele change. The column "Note" can have two values: "diff" means that there is a difference between the reference allele (variation interval) at the placement reported in HGVS name and the reference alleles reported in other HGVS names, and "rev" means that the sequence of this variation interval at the placement reported in HGVS name is in reverse orientation to the sequence(s) of this variation in other HGVS names not labeled as "rev".

Placement (CACAGCCTCACAAT)2CACA= delGCCTCACAATCACA dupGCCTCACAATCACA
GRCh38.p13 chr 10 NC_000010.11:g.286509_286540= NC_000010.11:g.286513GCCTCACAATCACA[1] NC_000010.11:g.286513GCCTCACAATCACA[3]
GRCh37.p13 chr 10 NC_000010.10:g.332449_332480= NC_000010.10:g.332453GCCTCACAATCACA[1] NC_000010.10:g.332453GCCTCACAATCACA[3]
DIP2C transcript NM_014974.2:c.4045-162= NM_014974.2:c.4045-175_4045-162del NM_014974.2:c.4045-189ATTGTGAGGCTGTG[3]
DIP2C transcript NM_014974.3:c.4045-162= NM_014974.3:c.4045-175_4045-162del NM_014974.3:c.4045-189ATTGTGAGGCTGTG[3]
DIP2C transcript variant X1 XM_005252426.1:c.4213-162= XM_005252426.1:c.4213-175_4213-162del XM_005252426.1:c.4213-189ATTGTGAGGCTGTG[3]
DIP2C transcript variant X4 XM_005252426.3:c.4213-162= XM_005252426.3:c.4213-175_4213-162del XM_005252426.3:c.4213-189ATTGTGAGGCTGTG[3]
DIP2C transcript variant X2 XM_005252427.1:c.4075-162= XM_005252427.1:c.4075-175_4075-162del XM_005252427.1:c.4075-189ATTGTGAGGCTGTG[3]
DIP2C transcript variant X6 XM_005252427.4:c.4075-162= XM_005252427.4:c.4075-175_4075-162del XM_005252427.4:c.4075-189ATTGTGAGGCTGTG[3]
DIP2C transcript variant X3 XM_005252428.1:c.4243-162= XM_005252428.1:c.4243-175_4243-162del XM_005252428.1:c.4243-189ATTGTGAGGCTGTG[3]
DIP2C transcript variant X2 XM_005252428.4:c.4243-162= XM_005252428.4:c.4243-175_4243-162del XM_005252428.4:c.4243-189ATTGTGAGGCTGTG[3]
DIP2C transcript variant X4 XM_005252429.1:c.3598-162= XM_005252429.1:c.3598-175_3598-162del XM_005252429.1:c.3598-189ATTGTGAGGCTGTG[3]
DIP2C transcript variant X8 XM_005252430.1:c.2134-162= XM_005252430.1:c.2134-175_2134-162del XM_005252430.1:c.2134-189ATTGTGAGGCTGTG[3]
DIP2C transcript variant X10 XM_005252430.3:c.2356-162= XM_005252430.3:c.2356-175_2356-162del XM_005252430.3:c.2356-189ATTGTGAGGCTGTG[3]
DIP2C transcript variant X1 XM_011519428.3:c.4255-162= XM_011519428.3:c.4255-175_4255-162del XM_011519428.3:c.4255-189ATTGTGAGGCTGTG[3]
DIP2C transcript variant X3 XM_011519429.3:c.4225-162= XM_011519429.3:c.4225-175_4225-162del XM_011519429.3:c.4225-189ATTGTGAGGCTGTG[3]
DIP2C transcript variant X5 XM_011519430.2:c.4087-162= XM_011519430.2:c.4087-175_4087-162del XM_011519430.2:c.4087-189ATTGTGAGGCTGTG[3]
DIP2C transcript variant X7 XM_011519431.2:c.4057-162= XM_011519431.2:c.4057-175_4057-162del XM_011519431.2:c.4057-189ATTGTGAGGCTGTG[3]
DIP2C transcript variant X8 XM_011519432.2:c.3754-162= XM_011519432.2:c.3754-175_3754-162del XM_011519432.2:c.3754-189ATTGTGAGGCTGTG[3]
DIP2C transcript variant X11 XM_011519433.3:c.2038-162= XM_011519433.3:c.2038-175_2038-162del XM_011519433.3:c.2038-189ATTGTGAGGCTGTG[3]
DIP2C transcript variant X9 XM_017015977.1:c.2386-162= XM_017015977.1:c.2386-175_2386-162del XM_017015977.1:c.2386-189ATTGTGAGGCTGTG[3]
Help

Submissions tab displays variations originally submitted to dbSNP, now supporting this RefSNP cluster (rs). We display Submitter handle, Submission identifier, Date and Build number, when the submission appeared for the first time. Direct submissions to dbSNP have Submission ID in the form of an ss-prefixed number (ss#). Other supporting variations are listed in the table without ss#.

6 SubSNP, 4 Frequency submissions
No Submitter Submission ID Date (Build)
1 TISHKOFF ss554500236 Apr 25, 2013 (138)
2 TOPMED ss2136342940 Dec 20, 2016 (150)
3 GNOMAD ss2884536247 Nov 08, 2017 (151)
4 TOPMED ss3109371952 Nov 08, 2017 (151)
5 TOPMED ss4839577196 Apr 26, 2021 (155)
6 TOMMO_GENOMICS ss5195854620 Apr 26, 2021 (155)
7 gnomAD - Genomes NC_000010.11 - 286509 Apr 26, 2021 (155)
8 8.3KJPN NC_000010.10 - 332449 Apr 26, 2021 (155)
9 TopMed NC_000010.11 - 286509 Apr 26, 2021 (155)
10 ALFA NC_000010.11 - 286509 Apr 26, 2021 (155)
Help

History tab displays RefSNPs (Associated ID) from previous builds (Build) that now support the current RefSNP, and the dates, when the history was updated for each Associated ID (History Updated).

Added to this RefSNP Cluster:
Submission IDs Observation SPDI Canonical SPDI Source RSIDs
53823927, ss2136342940, ss2884536247, ss5195854620 NC_000010.10:332448:CACAGCCTCACAAT: NC_000010.11:286508:CACAGCCTCACAAT…

NC_000010.11:286508:CACAGCCTCACAATCACAGCCTCACAATCACA:CACAGCCTCACAATCACA

(self)
ss554500236 NC_000010.10:332466:GCCTCACAATCACA: NC_000010.11:286508:CACAGCCTCACAAT…

NC_000010.11:286508:CACAGCCTCACAATCACAGCCTCACAATCACA:CACAGCCTCACAATCACA

(self)
340977769, 34636005, 55122851, ss3109371952, ss4839577196 NC_000010.11:286508:CACAGCCTCACAAT: NC_000010.11:286508:CACAGCCTCACAAT…

NC_000010.11:286508:CACAGCCTCACAATCACAGCCTCACAATCACA:CACAGCCTCACAATCACA

(self)
11750829556 NC_000010.11:286508:CACAGCCTCACAAT…

NC_000010.11:286508:CACAGCCTCACAATCACAGCCTCACAATCACA:CACAGCCTCACAATCACA

NC_000010.11:286508:CACAGCCTCACAAT…

NC_000010.11:286508:CACAGCCTCACAATCACAGCCTCACAATCACA:CACAGCCTCACAATCACA

(self)
11750829556 NC_000010.11:286508:CACAGCCTCACAAT…

NC_000010.11:286508:CACAGCCTCACAATCACAGCCTCACAATCACA:CACAGCCTCACAATCACAGCCTCACAATCACAGCCTCACAATCACA

NC_000010.11:286508:CACAGCCTCACAAT…

NC_000010.11:286508:CACAGCCTCACAATCACAGCCTCACAATCACA:CACAGCCTCACAATCACAGCCTCACAATCACAGCCTCACAATCACA

Help

Publications tab displays PubMed articles citing the variation as a listing of PMID, Title, Author, Year, Journal, ordered by Year, descending.

No publications for rs370960470

Help

The Flanks tab provides retrieving flanking sequences of a SNP on all molecules that have placements.

Genome context:
Select flank length:

Genomic regions, transcripts, and products
Top Help

NCBI Graphical Sequence Viewer display of the genomic region, transcripts and protein products for the reported RefSNP (rs).
Use the zoom option to view the nucleotides around the RefSNP and find other neighboring RefSNPs.
Visit Sequence Viewer for help with navigating inside the display and modifying the selection of displayed data tracks.

Software version is: 2.0.1.post596+ae089ad