Skip to main page content
Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation

dbSNP Short Genetic Variations

Welcome to the Reference SNP (rs) Report

All alleles are reported in the Forward orientation. Click on the Variant Details tab for details on Genomic Placement, Gene, and Amino Acid changes. HGVS names are in the HGVS tab.

Reference SNP (rs) Report

This page reports data for a single dbSNP Reference SNP variation (RefSNP or rs) from the new redesigned dbSNP build.
Top of the page reports a concise summary for the rs, with more specific details included in the corresponding tabs below.
All alleles are reported in the Forward orientation. Use the Genomic View to inspect the nucleotides flanking the variant, and its neighbors.
For more information see Help documentation.


Current Build 155

Released April 9, 2021

Homo sapiens
chr1:8342827-8342828 (GRCh38.p13) Help

The anchor position for this RefSNP. Includes all nucleotides potentially affected by this change, thus it can differ from HGVS, which is right-shifted. See here for details.



Variation Type
insTCACTTGAGCCCAGGG=0.18403 (3084/16758, 8.3KJPN)
insTCACTTGAGCCCAGGG=0.4614 (2054/4452, Estonian)
insTCACTTGAGCCCAGGG=0.4622 (2055/4446, ALFA) (+ 1 more)
insTCACTTGAGCCCAGGG=0.1430 (262/1832, Korea1K)
Clinical Significance
Not Reported in ClinVar
Gene : Consequence
SLC45A1 : Intron Variant
0 citations
Genomic View
See rs on genome

ALFA Allele Frequency
The ALFA project provide aggregate allele frequency from dbGaP. More information is available on the project page including descriptions, data access, and terms of use.

Release Version: 20201027095038
Population Group Sample Size Ref Allele Alt Allele
Total Global 4446 =0.5378 TCACTTGAGCCCAGGG=0.4622
European Sub 4438 =0.5376 TCACTTGAGCCCAGGG=0.4624
African Others Sub 0 =0 TCACTTGAGCCCAGGG=0
African American Sub 0 =0 TCACTTGAGCCCAGGG=0
East Asian Sub 0 =0 TCACTTGAGCCCAGGG=0
Other Asian Sub 0 =0 TCACTTGAGCCCAGGG=0
Latin American 1 Sub 0 =0 TCACTTGAGCCCAGGG=0
Latin American 2 Sub 0 =0 TCACTTGAGCCCAGGG=0
South Asian Sub 0 =0 TCACTTGAGCCCAGGG=0
Other Sub 8 =0.6 TCACTTGAGCCCAGGG=0.4


Frequency tab displays a table of the reference and alternate allele frequencies reported by various studies and populations. Table lines, where Population="Global" refer to the entire study population, whereas lines, where Group="Sub", refer to a study-specific population subgroupings (i.e. AFR, CAU, etc.), if available. Frequency for the alternate allele (Alt Allele) is a ratio of samples observed-to-total, where the numerator (observed samples) is the number of chromosomes in the study with the minor allele present (found in "Sample size", where Group="Sub"), and the denominator (total samples) is the total number of all chromosomes in the study for the variant (found in "Sample size", where Group="Study-wide" and Population="Global").

Study Population Group Sample Size Ref Allele Alt Allele
8.3KJPN JAPANESE Study-wide 16758 -

No frequency provided

Genetic variation in the Estonian population Estonian Study-wide 4452 -

No frequency provided

Korean Genome Project KOREAN Study-wide 1832 -

No frequency provided


Variant Details tab shows known variant placements on genomic sequences: chromosomes (NC_), RefSeqGene, pseudogenes or genomic regions (NG_), and in a separate table: on transcripts (NM_) and protein sequences (NP_). The corresponding transcript and protein locations are listed in adjacent lines, along with molecular consequences from Sequence Ontology. When no protein placement is available, only the transcript is listed. Column "Codon[Amino acid]" shows the actual base change in the format of "Reference > Alternate" allele, including the nucleotide codon change in transcripts, and the amino acid change in proteins, respectively, allowing for known ribosomal slippage sites. To view nucleotides adjacent to the variant use the Genomic View at the bottom of the page - zoom into the sequence until the nucleotides around the variant become visible.

Genomic Placements
Sequence name Change
GRCh38.p13 chr 1 NC_000001.11:g.8342827_8342828insTCACTTGAGCCCAGGG
GRCh38.p13 chr 1 NC_000001.11:g.8342827_8342828insTCACTTGAGCCCGGGAGGATCACTTGAGCCCAGGG
GRCh38.p13 chr 1 NC_000001.11:g.8342827_8342828insTCACTTGAGCTCAGGG
GRCh37.p13 chr 1 NC_000001.10:g.8402887_8402888insTCACTTGAGCCCAGGG
GRCh37.p13 chr 1 NC_000001.10:g.8402887_8402888insTCACTTGAGCCCGGGAGGATCACTTGAGCCCAGGG
GRCh37.p13 chr 1 NC_000001.10:g.8402887_8402888insTCACTTGAGCTCAGGG
SLC45A1 RefSeqGene NG_034025.1:g.29743_29744insTCACTTGAGCCCAGGG
SLC45A1 RefSeqGene NG_034025.1:g.29743_29744insTCACTTGAGCTCAGGG
Gene: SLC45A1, solute carrier family 45 member 1 (plus strand)
Molecule type Change Amino acid[Codon] SO Term
SLC45A1 transcript variant 2 NM_001080397.3:c.1981-920…


N/A Intron Variant
SLC45A1 transcript variant 1 NM_001379614.1:c.2005-920…


N/A Intron Variant
SLC45A1 transcript variant 3 NM_001379615.1:c.1912-920…


N/A Intron Variant
SLC45A1 transcript variant 4 NM_001379616.1:c.1888-920…


N/A Intron Variant
SLC45A1 transcript variant 5 NM_001379617.1:c.1399-920…


N/A Intron Variant
SLC45A1 transcript variant 6 NM_001379618.1:c.1375-920…


N/A Intron Variant
SLC45A1 transcript variant X4 XM_024447372.1:c.1399-920…


N/A Intron Variant

Clinical Significance tab shows a list of clinical significance entries from ClinVar associated with the variation, per allele. Click on the RCV accession (i.e. RCV000001615.2) or Allele ID (i.e. 12274) to access full ClinVar report.

Not Reported in ClinVar

Aliases tab displays HGVS names representing the variant placements and allele changes on genomic, transcript and protein sequences, per allele. HGVS name is an expression for reporting sequence accession and version, sequence type, position, and allele change. The column "Note" can have two values: "diff" means that there is a difference between the reference allele (variation interval) at the placement reported in HGVS name and the reference alleles reported in other HGVS names, and "rev" means that the sequence of this variation interval at the placement reported in HGVS name is in reverse orientation to the sequence(s) of this variation in other HGVS names not labeled as "rev".

GRCh38.p13 chr 1 NC_000001.11:g.8342827_8342828= NC_000001.11:g.8342827_8342828insTCACTTGAGCCCAGGG NC_000001.11:g.8342827_8342828insTCACTTGAGCCCGGGAGGATCACTTGAGCCCAGGG NC_000001.11:g.8342827_8342828insTCACTTGAGCTCAGGG
GRCh37.p13 chr 1 NC_000001.10:g.8402887_8402888= NC_000001.10:g.8402887_8402888insTCACTTGAGCCCAGGG NC_000001.10:g.8402887_8402888insTCACTTGAGCCCGGGAGGATCACTTGAGCCCAGGG NC_000001.10:g.8402887_8402888insTCACTTGAGCTCAGGG
SLC45A1 RefSeqGene NG_034025.1:g.29743_29744= NG_034025.1:g.29743_29744insTCACTTGAGCCCAGGG NG_034025.1:g.29743_29744insTCACTTGAGCCCGGGAGGATCACTTGAGCCCAGGG NG_034025.1:g.29743_29744insTCACTTGAGCTCAGGG
SLC45A1 transcript NM_001080397.1:c.1981-919= NM_001080397.1:c.1981-920_1981-919insTCACTTGAGCCCAGGG NM_001080397.1:c.1981-920_1981-919insTCACTTGAGCCCGGGAGGATCACTTGAGCCCAGGG NM_001080397.1:c.1981-920_1981-919insTCACTTGAGCTCAGGG
SLC45A1 transcript variant 2 NM_001080397.3:c.1981-919= NM_001080397.3:c.1981-920_1981-919insTCACTTGAGCCCAGGG NM_001080397.3:c.1981-920_1981-919insTCACTTGAGCCCGGGAGGATCACTTGAGCCCAGGG NM_001080397.3:c.1981-920_1981-919insTCACTTGAGCTCAGGG
SLC45A1 transcript variant 1 NM_001379614.1:c.2005-919= NM_001379614.1:c.2005-920_2005-919insTCACTTGAGCCCAGGG NM_001379614.1:c.2005-920_2005-919insTCACTTGAGCCCGGGAGGATCACTTGAGCCCAGGG NM_001379614.1:c.2005-920_2005-919insTCACTTGAGCTCAGGG
SLC45A1 transcript variant 3 NM_001379615.1:c.1912-919= NM_001379615.1:c.1912-920_1912-919insTCACTTGAGCCCAGGG NM_001379615.1:c.1912-920_1912-919insTCACTTGAGCCCGGGAGGATCACTTGAGCCCAGGG NM_001379615.1:c.1912-920_1912-919insTCACTTGAGCTCAGGG
SLC45A1 transcript variant 4 NM_001379616.1:c.1888-919= NM_001379616.1:c.1888-920_1888-919insTCACTTGAGCCCAGGG NM_001379616.1:c.1888-920_1888-919insTCACTTGAGCCCGGGAGGATCACTTGAGCCCAGGG NM_001379616.1:c.1888-920_1888-919insTCACTTGAGCTCAGGG
SLC45A1 transcript variant 5 NM_001379617.1:c.1399-919= NM_001379617.1:c.1399-920_1399-919insTCACTTGAGCCCAGGG NM_001379617.1:c.1399-920_1399-919insTCACTTGAGCCCGGGAGGATCACTTGAGCCCAGGG NM_001379617.1:c.1399-920_1399-919insTCACTTGAGCTCAGGG
SLC45A1 transcript variant 6 NM_001379618.1:c.1375-919= NM_001379618.1:c.1375-920_1375-919insTCACTTGAGCCCAGGG NM_001379618.1:c.1375-920_1375-919insTCACTTGAGCCCGGGAGGATCACTTGAGCCCAGGG NM_001379618.1:c.1375-920_1375-919insTCACTTGAGCTCAGGG
SLC45A1 transcript variant X1 XM_005263467.1:c.1981-919= XM_005263467.1:c.1981-920_1981-919insTCACTTGAGCCCAGGG XM_005263467.1:c.1981-920_1981-919insTCACTTGAGCCCGGGAGGATCACTTGAGCCCAGGG XM_005263467.1:c.1981-920_1981-919insTCACTTGAGCTCAGGG
SLC45A1 transcript variant X4 XM_024447372.1:c.1399-919= XM_024447372.1:c.1399-920_1399-919insTCACTTGAGCCCAGGG XM_024447372.1:c.1399-920_1399-919insTCACTTGAGCCCGGGAGGATCACTTGAGCCCAGGG XM_024447372.1:c.1399-920_1399-919insTCACTTGAGCTCAGGG

Submissions tab displays variations originally submitted to dbSNP, now supporting this RefSNP cluster (rs). We display Submitter handle, Submission identifier, Date and Build number, when the submission appeared for the first time. Direct submissions to dbSNP have Submission ID in the form of an ss-prefixed number (ss#). Other supporting variations are listed in the table without ss#.

14 SubSNP, 7 Frequency submissions
No Submitter Submission ID Date (Build)
1 HGSV ss80793888 Dec 15, 2007 (129)
2 SYSTEMSBIOZJU ss2137334793 Nov 08, 2017 (151)
3 SWEGEN ss2986261999 Nov 08, 2017 (151)
4 MCHAISSO ss3064388728 Nov 08, 2017 (151)
5 EGCUT_WGS ss3654361890 Jul 12, 2019 (153)
6 PACBIO ss3783319162 Jul 12, 2019 (153)
7 EVA ss3826013819 Apr 25, 2020 (154)
8 EVA ss3836394212 Apr 25, 2020 (154)
9 EVA ss3841798630 Apr 25, 2020 (154)
10 KOGIC ss3943775185 Apr 25, 2020 (154)
11 GNOMAD ss3987960174 Apr 25, 2021 (155)
12 GNOMAD ss3987960175 Apr 25, 2021 (155)
13 GNOMAD ss3987960176 Apr 25, 2021 (155)
14 TOMMO_GENOMICS ss5142371030 Apr 25, 2021 (155)
15 Genetic variation in the Estonian population NC_000001.10 - 8402888 Oct 11, 2018 (152)
16 gnomAD - Genomes

Submission ignored due to conflicting rows:
Row 1877199 (NC_000001.11:8342827::TCACTTGAGCCCAGGG 54754/138088)
Row 1877200 (NC_000001.11:8342827::TCACTTGAGCCCGGGAGGATCACTTGAGCCCAGGG 1/138208)
Row 1877201 (NC_000001.11:8342827::TCACTTGAGCTCAGGG 1/138208)

- Apr 25, 2021 (155)
17 gnomAD - Genomes

Submission ignored due to conflicting rows:
Row 1877199 (NC_000001.11:8342827::TCACTTGAGCCCAGGG 54754/138088)
Row 1877200 (NC_000001.11:8342827::TCACTTGAGCCCGGGAGGATCACTTGAGCCCAGGG 1/138208)
Row 1877201 (NC_000001.11:8342827::TCACTTGAGCTCAGGG 1/138208)

- Apr 25, 2021 (155)
18 gnomAD - Genomes

Submission ignored due to conflicting rows:
Row 1877199 (NC_000001.11:8342827::TCACTTGAGCCCAGGG 54754/138088)
Row 1877200 (NC_000001.11:8342827::TCACTTGAGCCCGGGAGGATCACTTGAGCCCAGGG 1/138208)
Row 1877201 (NC_000001.11:8342827::TCACTTGAGCTCAGGG 1/138208)

- Apr 25, 2021 (155)
19 Korean Genome Project NC_000001.11 - 8342828 Apr 25, 2020 (154)
20 8.3KJPN NC_000001.10 - 8402888 Apr 25, 2021 (155)
21 ALFA NC_000001.11 - 8342828 Apr 25, 2021 (155)

History tab displays RefSNPs (Associated ID) from previous builds (Build) that now support the current RefSNP, and the dates, when the history was updated for each Associated ID (History Updated).

Added to this RefSNP Cluster:
Submission IDs Observation SPDI Canonical SPDI Source RSIDs
100138, 340337, ss2137334793, ss2986261999, ss3654361890, ss3783319162, ss3826013819, ss3836394212, ss5142371030 NC_000001.10:8402887::TCACTTGAGCCC…




153186, 7306227192, ss3064388728, ss3841798630, ss3943775185, ss3987960174 NC_000001.11:8342827::TCACTTGAGCCC…




ss80793888 NT_021937.19:4407619::TCACTTGAGCCC…




ss3987960175 NC_000001.11:8342827::TCACTTGAGCCC…




ss3987960176 NC_000001.11:8342827::TCACTTGAGCTC…




Removed from this RefSNP Cluster:
Submission IDs Observation SPDI Canonical SPDI Destination RSIDs





Publications tab displays PubMed articles citing the variation as a listing of PMID, Title, Author, Year, Journal, ordered by Year, descending.

No publications for rs59005659


The Flanks tab provides retrieving flanking sequences of a SNP on all molecules that have placements.

Genome context:
Select flank length:

Genomic regions, transcripts, and products
Top Help

NCBI Graphical Sequence Viewer display of the genomic region, transcripts and protein products for the reported RefSNP (rs).
Use the zoom option to view the nucleotides around the RefSNP and find other neighboring RefSNPs.
Visit Sequence Viewer for help with navigating inside the display and modifying the selection of displayed data tracks.

Software version is: 2.0.1.post629+eb05767