Skip to main page content
Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation

dbSNP Short Genetic Variations

Welcome to the Reference SNP (rs) Report

All alleles are reported in the Forward orientation. Click on the Variant Details tab for details on Genomic Placement, Gene, and Amino Acid changes. HGVS names are in the HGVS tab.

Reference SNP (rs) Report

This page reports data for a single dbSNP Reference SNP variation (RefSNP or rs) from the new redesigned dbSNP build.
Top of the page reports a concise summary for the rs, with more specific details included in the corresponding tabs below.
All alleles are reported in the Forward orientation. Use the Genomic View to inspect the nucleotides flanking the variant, and its neighbors.
For more information see Help documentation.

rs893459718

Current Build 155

Released April 9, 2021

Organism
Homo sapiens
Position
chr10:247095-247109 (GRCh38.p13) Help

The anchor position for this RefSNP. Includes all nucleotides potentially affected by this change, thus it can differ from HGVS, which is right-shifted. See here for details.

Alleles
dupGTGCTCTGCAAA
Variation Type
Indel Insertion and Deletion
Frequency
dupGTGCTCTGCAAA=0.000004 (1/264690, TOPMED)
dupGTGCTCTGCAAA=0.000014 (2/140270, GnomAD)
dupGTGCTCTGCAAA=0.00000 (0/14050, ALFA)
Clinical Significance
Not Reported in ClinVar
Gene : Consequence
ZMYND11 : Intron Variant
LOC107984190 : Intron Variant
Publications
0 citations
Genomic View
See rs on genome
Help

Variant Details tab shows known variant placements on genomic sequences: chromosomes (NC_), RefSeqGene, pseudogenes or genomic regions (NG_), and in a separate table: on transcripts (NM_) and protein sequences (NP_). The corresponding transcript and protein locations are listed in adjacent lines, along with molecular consequences from Sequence Ontology. When no protein placement is available, only the transcript is listed. Column "Codon[Amino acid]" shows the actual base change in the format of "Reference > Alternate" allele, including the nucleotide codon change in transcripts, and the amino acid change in proteins, respectively, allowing for known ribosomal slippage sites. To view nucleotides adjacent to the variant use the Genomic View at the bottom of the page - zoom into the sequence until the nucleotides around the variant become visible.

Genomic Placements
Sequence name Change
GRCh38.p13 chr 10 NC_000010.11:g.247098_247109dup
GRCh37.p13 chr 10 NC_000010.10:g.293038_293049dup
ZMYND11 RefSeqGene NG_029960.1:g.117634_117645dup
Gene: ZMYND11, zinc finger MYND-type containing 11 (plus strand)
Molecule type Change Amino acid[Codon] SO Term
ZMYND11 transcript variant 4 NM_001202464.3:c.996+125_…

NM_001202464.3:c.996+125_996+136dup

N/A Intron Variant
ZMYND11 transcript variant 5 NM_001202465.3:c.903+125_…

NM_001202465.3:c.903+125_903+136dup

N/A Intron Variant
ZMYND11 transcript variant 6 NM_001202466.3:c.993+125_…

NM_001202466.3:c.993+125_993+136dup

N/A Intron Variant
ZMYND11 transcript variant 7 NM_001202467.1:c.996+125_…

NM_001202467.1:c.996+125_996+136dup

N/A Intron Variant
ZMYND11 transcript variant 8 NM_001202468.1:c.1158+125…

NM_001202468.1:c.1158+125_1158+136dup

N/A Intron Variant
ZMYND11 transcript variant 9 NM_001330057.3:c.1107+125…

NM_001330057.3:c.1107+125_1107+136dup

N/A Intron Variant
ZMYND11 transcript variant 10 NM_001370097.3:c.1158+125…

NM_001370097.3:c.1158+125_1158+136dup

N/A Intron Variant
ZMYND11 transcript variant 11 NM_001370098.2:c.1158+125…

NM_001370098.2:c.1158+125_1158+136dup

N/A Intron Variant
ZMYND11 transcript variant 12 NM_001370099.2:c.1158+125…

NM_001370099.2:c.1158+125_1158+136dup

N/A Intron Variant
ZMYND11 transcript variant 13 NM_001370100.5:c.1158+125…

NM_001370100.5:c.1158+125_1158+136dup

N/A Intron Variant
ZMYND11 transcript variant 14 NM_001370101.2:c.1158+125…

NM_001370101.2:c.1158+125_1158+136dup

N/A Intron Variant
ZMYND11 transcript variant 15 NM_001370102.2:c.1158+125…

NM_001370102.2:c.1158+125_1158+136dup

N/A Intron Variant
ZMYND11 transcript variant 16 NM_001370103.2:c.996+125_…

NM_001370103.2:c.996+125_996+136dup

N/A Intron Variant
ZMYND11 transcript variant 17 NM_001370104.2:c.996+125_…

NM_001370104.2:c.996+125_996+136dup

N/A Intron Variant
ZMYND11 transcript variant 18 NM_001370105.2:c.996+125_…

NM_001370105.2:c.996+125_996+136dup

N/A Intron Variant
ZMYND11 transcript variant 19 NM_001370106.2:c.996+125_…

NM_001370106.2:c.996+125_996+136dup

N/A Intron Variant
ZMYND11 transcript variant 20 NM_001370107.2:c.996+125_…

NM_001370107.2:c.996+125_996+136dup

N/A Intron Variant
ZMYND11 transcript variant 21 NM_001370108.2:c.996+125_…

NM_001370108.2:c.996+125_996+136dup

N/A Intron Variant
ZMYND11 transcript variant 22 NM_001370109.2:c.996+125_…

NM_001370109.2:c.996+125_996+136dup

N/A Intron Variant
ZMYND11 transcript variant 23 NM_001370110.2:c.903+125_…

NM_001370110.2:c.903+125_903+136dup

N/A Intron Variant
ZMYND11 transcript variant 24 NM_001370111.2:c.993+125_…

NM_001370111.2:c.993+125_993+136dup

N/A Intron Variant
ZMYND11 transcript variant 25 NM_001370112.2:c.1107+125…

NM_001370112.2:c.1107+125_1107+136dup

N/A Intron Variant
ZMYND11 transcript variant 26 NM_001370113.2:c.1065+125…

NM_001370113.2:c.1065+125_1065+136dup

N/A Intron Variant
ZMYND11 transcript variant 27 NM_001370114.2:c.1065+125…

NM_001370114.2:c.1065+125_1065+136dup

N/A Intron Variant
ZMYND11 transcript variant 28 NM_001370115.2:c.1155+125…

NM_001370115.2:c.1155+125_1155+136dup

N/A Intron Variant
ZMYND11 transcript variant 29 NM_001370116.2:c.1092+125…

NM_001370116.2:c.1092+125_1092+136dup

N/A Intron Variant
ZMYND11 transcript variant 30 NM_001370117.2:c.1158+125…

NM_001370117.2:c.1158+125_1158+136dup

N/A Intron Variant
ZMYND11 transcript variant 31 NM_001370118.2:c.1038+125…

NM_001370118.2:c.1038+125_1038+136dup

N/A Intron Variant
ZMYND11 transcript variant 32 NM_001370119.2:c.1080+125…

NM_001370119.2:c.1080+125_1080+136dup

N/A Intron Variant
ZMYND11 transcript variant 33 NM_001370120.2:c.930+125_…

NM_001370120.2:c.930+125_930+136dup

N/A Intron Variant
ZMYND11 transcript variant 34 NM_001370121.2:c.876+125_…

NM_001370121.2:c.876+125_876+136dup

N/A Intron Variant
ZMYND11 transcript variant 35 NM_001370122.2:c.852+125_…

NM_001370122.2:c.852+125_852+136dup

N/A Intron Variant
ZMYND11 transcript variant 36 NM_001370123.2:c.801+125_…

NM_001370123.2:c.801+125_801+136dup

N/A Intron Variant
ZMYND11 transcript variant 37 NM_001370124.3:c.687+125_…

NM_001370124.3:c.687+125_687+136dup

N/A Intron Variant
ZMYND11 transcript variant 1 NM_006624.7:c.1158+125_11…

NM_006624.7:c.1158+125_1158+136dup

N/A Intron Variant
ZMYND11 transcript variant 2 NM_212479.4:c.1155+125_11…

NM_212479.4:c.1155+125_1155+136dup

N/A Intron Variant
ZMYND11 transcript variant 38 NR_163254.2:n. N/A Intron Variant
ZMYND11 transcript variant X12 XM_017015594.1:c.945+125_…

XM_017015594.1:c.945+125_945+136dup

N/A Intron Variant
Gene: LOC107984190, uncharacterized LOC107984190 (minus strand)
Molecule type Change Amino acid[Codon] SO Term
LOC107984190 transcript XR_001747314.1:n. N/A Intron Variant
Help

Clinical Significance tab shows a list of clinical significance entries from ClinVar associated with the variation, per allele. Click on the RCV accession (i.e. RCV000001615.2) or Allele ID (i.e. 12274) to access full ClinVar report.

Not Reported in ClinVar

ALFA Allele Frequency (New)
The ALFA project provide aggregate allele frequency from dbGaP. More information is available on the project page including descriptions, data access, and terms of use.

Release Version: 20201027095038
Population Group Sample Size Ref Allele Alt Allele
Total Global 14050 AAAGTGCTCTGCAAA=1.00000 AAAGTGCTCTGCAAAGTGCTCTGCAAA=0.00000
European Sub 9690 AAAGTGCTCTGCAAA=1.0000 AAAGTGCTCTGCAAAGTGCTCTGCAAA=0.0000
African Sub 2898 AAAGTGCTCTGCAAA=1.0000 AAAGTGCTCTGCAAAGTGCTCTGCAAA=0.0000
African Others Sub 114 AAAGTGCTCTGCAAA=1.000 AAAGTGCTCTGCAAAGTGCTCTGCAAA=0.000
African American Sub 2784 AAAGTGCTCTGCAAA=1.0000 AAAGTGCTCTGCAAAGTGCTCTGCAAA=0.0000
Asian Sub 112 AAAGTGCTCTGCAAA=1.000 AAAGTGCTCTGCAAAGTGCTCTGCAAA=0.000
East Asian Sub 86 AAAGTGCTCTGCAAA=1.00 AAAGTGCTCTGCAAAGTGCTCTGCAAA=0.00
Other Asian Sub 26 AAAGTGCTCTGCAAA=1.00 AAAGTGCTCTGCAAAGTGCTCTGCAAA=0.00
Latin American 1 Sub 146 AAAGTGCTCTGCAAA=1.000 AAAGTGCTCTGCAAAGTGCTCTGCAAA=0.000
Latin American 2 Sub 610 AAAGTGCTCTGCAAA=1.000 AAAGTGCTCTGCAAAGTGCTCTGCAAA=0.000
South Asian Sub 98 AAAGTGCTCTGCAAA=1.00 AAAGTGCTCTGCAAAGTGCTCTGCAAA=0.00
Other Sub 496 AAAGTGCTCTGCAAA=1.000 AAAGTGCTCTGCAAAGTGCTCTGCAAA=0.000


Help

Frequency tab displays a table of the reference and alternate allele frequencies reported by various studies and populations. Table lines, where Population="Global" refer to the entire study population, whereas lines, where Group="Sub", refer to a study-specific population subgroupings (i.e. AFR, CAU, etc.), if available. Frequency for the alternate allele (Alt Allele) is a ratio of samples observed-to-total, where the numerator (observed samples) is the number of chromosomes in the study with the minor allele present (found in "Sample size", where Group="Sub"), and the denominator (total samples) is the total number of all chromosomes in the study for the variant (found in "Sample size", where Group="Study-wide" and Population="Global").

Download
Study Population Group Sample Size Ref Allele Alt Allele
TopMed Global Study-wide 264690 -

No frequency provided

dupGTGCTCTGCAAA=0.000004
gnomAD - Genomes Global Study-wide 140270 -

No frequency provided

dupGTGCTCTGCAAA=0.000014
gnomAD - Genomes European Sub 75950 -

No frequency provided

dupGTGCTCTGCAAA=0.00000
gnomAD - Genomes African Sub 42048 -

No frequency provided

dupGTGCTCTGCAAA=0.00005
gnomAD - Genomes American Sub 13664 -

No frequency provided

dupGTGCTCTGCAAA=0.00000
gnomAD - Genomes Ashkenazi Jewish Sub 3322 -

No frequency provided

dupGTGCTCTGCAAA=0.0000
gnomAD - Genomes East Asian Sub 3132 -

No frequency provided

dupGTGCTCTGCAAA=0.0000
gnomAD - Genomes Other Sub 2154 -

No frequency provided

dupGTGCTCTGCAAA=0.0000
Allele Frequency Aggregator Total Global 14050 AAAGTGCTCTGCAAA=1.00000 dupGTGCTCTGCAAA=0.00000
Allele Frequency Aggregator European Sub 9690 AAAGTGCTCTGCAAA=1.0000 dupGTGCTCTGCAAA=0.0000
Allele Frequency Aggregator African Sub 2898 AAAGTGCTCTGCAAA=1.0000 dupGTGCTCTGCAAA=0.0000
Allele Frequency Aggregator Latin American 2 Sub 610 AAAGTGCTCTGCAAA=1.000 dupGTGCTCTGCAAA=0.000
Allele Frequency Aggregator Other Sub 496 AAAGTGCTCTGCAAA=1.000 dupGTGCTCTGCAAA=0.000
Allele Frequency Aggregator Latin American 1 Sub 146 AAAGTGCTCTGCAAA=1.000 dupGTGCTCTGCAAA=0.000
Allele Frequency Aggregator Asian Sub 112 AAAGTGCTCTGCAAA=1.000 dupGTGCTCTGCAAA=0.000
Allele Frequency Aggregator South Asian Sub 98 AAAGTGCTCTGCAAA=1.00 dupGTGCTCTGCAAA=0.00
Help

Aliases tab displays HGVS names representing the variant placements and allele changes on genomic, transcript and protein sequences, per allele. HGVS name is an expression for reporting sequence accession and version, sequence type, position, and allele change. The column "Note" can have two values: "diff" means that there is a difference between the reference allele (variation interval) at the placement reported in HGVS name and the reference alleles reported in other HGVS names, and "rev" means that the sequence of this variation interval at the placement reported in HGVS name is in reverse orientation to the sequence(s) of this variation in other HGVS names not labeled as "rev".

Placement AAAGTGCTCTGCAAA= dupGTGCTCTGCAAA
GRCh38.p13 chr 10 NC_000010.11:g.247095_247109= NC_000010.11:g.247098_247109dup
GRCh37.p13 chr 10 NC_000010.10:g.293035_293049= NC_000010.10:g.293038_293049dup
ZMYND11 RefSeqGene NG_029960.1:g.117631_117645= NG_029960.1:g.117634_117645dup
ZMYND11 transcript variant 4 NM_001202464.1:c.996+122= NM_001202464.1:c.996+125_996+136dup
ZMYND11 transcript variant 4 NM_001202464.3:c.996+122= NM_001202464.3:c.996+125_996+136dup
ZMYND11 transcript variant 5 NM_001202465.1:c.903+122= NM_001202465.1:c.903+125_903+136dup
ZMYND11 transcript variant 5 NM_001202465.3:c.903+122= NM_001202465.3:c.903+125_903+136dup
ZMYND11 transcript variant 6 NM_001202466.1:c.993+122= NM_001202466.1:c.993+125_993+136dup
ZMYND11 transcript variant 6 NM_001202466.3:c.993+122= NM_001202466.3:c.993+125_993+136dup
ZMYND11 transcript variant 7 NM_001202467.1:c.996+122= NM_001202467.1:c.996+125_996+136dup
ZMYND11 transcript variant 8 NM_001202468.1:c.1158+122= NM_001202468.1:c.1158+125_1158+136dup
ZMYND11 transcript variant 9 NM_001330057.3:c.1107+122= NM_001330057.3:c.1107+125_1107+136dup
ZMYND11 transcript variant 10 NM_001370097.3:c.1158+122= NM_001370097.3:c.1158+125_1158+136dup
ZMYND11 transcript variant 11 NM_001370098.2:c.1158+122= NM_001370098.2:c.1158+125_1158+136dup
ZMYND11 transcript variant 12 NM_001370099.2:c.1158+122= NM_001370099.2:c.1158+125_1158+136dup
ZMYND11 transcript variant 13 NM_001370100.5:c.1158+122= NM_001370100.5:c.1158+125_1158+136dup
ZMYND11 transcript variant 14 NM_001370101.2:c.1158+122= NM_001370101.2:c.1158+125_1158+136dup
ZMYND11 transcript variant 15 NM_001370102.2:c.1158+122= NM_001370102.2:c.1158+125_1158+136dup
ZMYND11 transcript variant 16 NM_001370103.2:c.996+122= NM_001370103.2:c.996+125_996+136dup
ZMYND11 transcript variant 17 NM_001370104.2:c.996+122= NM_001370104.2:c.996+125_996+136dup
ZMYND11 transcript variant 18 NM_001370105.2:c.996+122= NM_001370105.2:c.996+125_996+136dup
ZMYND11 transcript variant 19 NM_001370106.2:c.996+122= NM_001370106.2:c.996+125_996+136dup
ZMYND11 transcript variant 20 NM_001370107.2:c.996+122= NM_001370107.2:c.996+125_996+136dup
ZMYND11 transcript variant 21 NM_001370108.2:c.996+122= NM_001370108.2:c.996+125_996+136dup
ZMYND11 transcript variant 22 NM_001370109.2:c.996+122= NM_001370109.2:c.996+125_996+136dup
ZMYND11 transcript variant 23 NM_001370110.2:c.903+122= NM_001370110.2:c.903+125_903+136dup
ZMYND11 transcript variant 24 NM_001370111.2:c.993+122= NM_001370111.2:c.993+125_993+136dup
ZMYND11 transcript variant 25 NM_001370112.2:c.1107+122= NM_001370112.2:c.1107+125_1107+136dup
ZMYND11 transcript variant 26 NM_001370113.2:c.1065+122= NM_001370113.2:c.1065+125_1065+136dup
ZMYND11 transcript variant 27 NM_001370114.2:c.1065+122= NM_001370114.2:c.1065+125_1065+136dup
ZMYND11 transcript variant 28 NM_001370115.2:c.1155+122= NM_001370115.2:c.1155+125_1155+136dup
ZMYND11 transcript variant 29 NM_001370116.2:c.1092+122= NM_001370116.2:c.1092+125_1092+136dup
ZMYND11 transcript variant 30 NM_001370117.2:c.1158+122= NM_001370117.2:c.1158+125_1158+136dup
ZMYND11 transcript variant 31 NM_001370118.2:c.1038+122= NM_001370118.2:c.1038+125_1038+136dup
ZMYND11 transcript variant 32 NM_001370119.2:c.1080+122= NM_001370119.2:c.1080+125_1080+136dup
ZMYND11 transcript variant 33 NM_001370120.2:c.930+122= NM_001370120.2:c.930+125_930+136dup
ZMYND11 transcript variant 34 NM_001370121.2:c.876+122= NM_001370121.2:c.876+125_876+136dup
ZMYND11 transcript variant 35 NM_001370122.2:c.852+122= NM_001370122.2:c.852+125_852+136dup
ZMYND11 transcript variant 36 NM_001370123.2:c.801+122= NM_001370123.2:c.801+125_801+136dup
ZMYND11 transcript variant 37 NM_001370124.3:c.687+122= NM_001370124.3:c.687+125_687+136dup
ZMYND11 transcript variant 1 NM_006624.5:c.1158+122= NM_006624.5:c.1158+125_1158+136dup
ZMYND11 transcript variant 1 NM_006624.7:c.1158+122= NM_006624.7:c.1158+125_1158+136dup
ZMYND11 transcript variant 2 NM_212479.3:c.1155+122= NM_212479.3:c.1155+125_1155+136dup
ZMYND11 transcript variant 2 NM_212479.4:c.1155+122= NM_212479.4:c.1155+125_1155+136dup
ZMYND11 transcript variant X1 XM_005252359.1:c.1158+122= XM_005252359.1:c.1158+125_1158+136dup
ZMYND11 transcript variant X2 XM_005252360.1:c.1155+122= XM_005252360.1:c.1155+125_1155+136dup
ZMYND11 transcript variant X3 XM_005252361.1:c.996+122= XM_005252361.1:c.996+125_996+136dup
ZMYND11 transcript variant X5 XM_005252362.1:c.996+122= XM_005252362.1:c.996+125_996+136dup
ZMYND11 transcript variant X5 XM_005252363.1:c.993+122= XM_005252363.1:c.993+125_993+136dup
ZMYND11 transcript variant X12 XM_017015594.1:c.945+122= XM_017015594.1:c.945+125_945+136dup
Help

Submissions tab displays variations originally submitted to dbSNP, now supporting this RefSNP cluster (rs). We display Submitter handle, Submission identifier, Date and Build number, when the submission appeared for the first time. Direct submissions to dbSNP have Submission ID in the form of an ss-prefixed number (ss#). Other supporting variations are listed in the table without ss#.

4 SubSNP, 3 Frequency submissions
No Submitter Submission ID Date (Build)
1 TOPMED ss2136342937 Dec 20, 2016 (150)
2 TOPMED ss3109363476 Nov 08, 2017 (151)
3 GNOMAD ss4211439305 Apr 26, 2021 (155)
4 TOPMED ss4839565946 Apr 26, 2021 (155)
5 gnomAD - Genomes NC_000010.11 - 247095 Apr 26, 2021 (155)
6 TopMed NC_000010.11 - 247095 Apr 26, 2021 (155)
7 ALFA NC_000010.11 - 247095 Apr 26, 2021 (155)
Help

History tab displays RefSNPs (Associated ID) from previous builds (Build) that now support the current RefSNP, and the dates, when the history was updated for each Associated ID (History Updated).

Added to this RefSNP Cluster:
Submission IDs Observation SPDI Canonical SPDI Source RSIDs
ss2136342937 NC_000010.10:293034::AAAGTGCTCTGC NC_000010.11:247094:AAAGTGCTCTGCAA…

NC_000010.11:247094:AAAGTGCTCTGCAAA:AAAGTGCTCTGCAAAGTGCTCTGCAAA

(self)
340968470, 34628897, 55111601, ss3109363476, ss4211439305, ss4839565946 NC_000010.11:247094::AAAGTGCTCTGC NC_000010.11:247094:AAAGTGCTCTGCAA…

NC_000010.11:247094:AAAGTGCTCTGCAAA:AAAGTGCTCTGCAAAGTGCTCTGCAAA

(self)
1170153498 NC_000010.11:247094:AAAGTGCTCTGCAA…

NC_000010.11:247094:AAAGTGCTCTGCAAA:AAAGTGCTCTGCAAAGTGCTCTGCAAA

NC_000010.11:247094:AAAGTGCTCTGCAA…

NC_000010.11:247094:AAAGTGCTCTGCAAA:AAAGTGCTCTGCAAAGTGCTCTGCAAA

(self)
Help

Publications tab displays PubMed articles citing the variation as a listing of PMID, Title, Author, Year, Journal, ordered by Year, descending.

No publications for rs893459718

Help

The Flanks tab provides retrieving flanking sequences of a SNP on all molecules that have placements.

Genome context:
Select flank length:

Genomic regions, transcripts, and products
Top Help

NCBI Graphical Sequence Viewer display of the genomic region, transcripts and protein products for the reported RefSNP (rs).
Use the zoom option to view the nucleotides around the RefSNP and find other neighboring RefSNPs.
Visit Sequence Viewer for help with navigating inside the display and modifying the selection of displayed data tracks.

Software version is: 2.0.1.post596+ae089ad