Instrument: Illumina MiSeq
Strategy: RNA-Seq
Source: TRANSCRIPTOMIC
Selection: cDNA
Layout: PAIRED
Construction protocol: Trizol lysis of whole spleen cell suspension, RNA fraction c-DNA synthesis with gene-specific primer against the immunoglobulin heavy chain constant domain adjacent to the variable region, and including an UMI tag. c-DNA was futher amplified by a multiplex PCR method with primers complementary to the 5'UTR of the immunoglobulins. The 6-base random UMI tag is located ajacent to the (T7) reverse priming site (CTCCCTATAGTGAGTCGTATTA) that was also introduced during cDNA synthesis