Format

Send to:

Choose Destination

SRX5552322: SIVmac251 gag from nave macaque
1 ILLUMINA (Illumina MiSeq) run: 1.7M spots, 741.9M bases, 423.7Mb downloads

Design: SIVmac251 RNA was extracted around peak viraemia (between day 7 and 21). Full length SIV gag was amplified as a single amplicon using forward (CCTGAGTACGGCTGAGTGAA) and reverse (TGGACCTAACTCTATTCCTGTTACA) primers. Bar-coded libraries of amplicons were made using Nextera XT library preparation kit, equimolar amounts of each sample sequenced in 250 bp paired-end MiSeq V500 sequencing reactions (both Illumina).
Submitted by: National Institute of Biological Standards and Control
Study: SIVmac251 in vaccinated and naive cynomolgus macaques.
show Abstracthide Abstract
Vaccines aimed at inducing T cell responses to protect against human immunodeficiency virus (HIV) infection have been under development for more than 15 years. Replication defective adenovirus (rAd) vaccine vectors are at the forefront of this work and tested extensively in the simian immunodeficiency virus (SIV) challenge macaque model. Mauritian cynomologus macaques, Macaca fascicularis (MCM), vaccinated against unmodified gag alone with a DNA prime followed by a rAd boost exhibit increased protection from infection by repeated intrarectal challenge with low dose SIVmac251. There was no evidence of infection followed by eradication. A significant correlation was observed between cytokine expression by CD4 T cells and delayed infection. Vaccination with gag fused to the ubiquitin gene or fragmented to increase CD8 magnitude and breadth did not confer resistance to challenge or enhance immunity. On infection a significant reduction in peak virus load was observed in all vaccinated animals including those vaccinated with modified gag. These findings suggest that a non-persistent viral vector vaccine coding for internal virus proteins may be able to protect against HIV infection. The mechanisms are probably distinct from antibody-mediated virus neutralization or cytotoxic CD8 cell killing of virus infected cells and may be mediated in part by CD4 T cells. The plasma from vaccinated and naive subjects was sampled at peak viraemia. These sequences represent the gag region of SIVmac251 amplified from plasma viral RNA.
Sample:
SAMN11178435 • SRS4517803 • All experiments • All runs
Library:
Name: J19_22Nov13
Instrument: Illumina MiSeq
Strategy: AMPLICON
Source: VIRAL RNA
Selection: RT-PCR
Layout: PAIRED
Runs: 1 run, 1.7M spots, 741.9M bases, 423.7Mb
Run# of Spots# of BasesSizePublished
SRR87618291,745,547741.9M423.7Mb2019-03-21

ID:
7496350

Supplemental Content

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center