U.S. flag

An official website of the United States government

Format

Send to:

Choose Destination

Links from BioSample

SRX5809952: G. stearothermophilus opt. TruSeq rep1
1 ILLUMINA (Illumina MiSeq) run: 2.8M spots, 279.2M bases, 117Mb downloads

Design: G. stearothermophilus cells were cultivated in medium 220 at 50°C. For total RNA isolation, Trizol was added to the disrupted cells. Total RNA and 3'-adapter (5'-pUGGAATTCTCGGGTGCCAAGG-amino-C7-3') were ligated. The SuperScript IV RT were added. The cDNA was separated on a poly-acrylamide gel. The DNA-only version of the Illumina TruSeq small RNA kit adapter (5'-pGATCGTCGGACTGTAGAACTCTGAAC-AminoC6-3') was ligated to the gel-purified cDNA. cDNA carrying 5' and 3' adapter sequences was incubated and amplified with the Illumina 5' PCR primer for TruSeq small RNA (5'- AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGA-3') and a custom index primer (5'-CAAGCAGAAGACGGCATACGAGATNNNNNNTAGGACTCCATGCAAGCTCGGTACCGACAGTG-3'). High-throughput analysis of the libraries was done as single end run (150 nt) on a Illumina MiSeq System with the custom primer (5'-CACTGTCGGTACCGAGCTTGCATGGAGTCCTA-3').
Submitted by: University of Leipzig
Study: LOTTE-Seq: Highly specific selection of tRNAs with 3'-CCA end for high-throughput sequencing
show Abstracthide Abstract
Currently available methods do not sample the entire tRNA pool or lack specificity for tRNAs. Combining and optimizing high-throughput sequencing methods, we developed Lotte-seq a highly specific protocol for efficient and comprehensive analysis of tRNAs. Ligation of a hairpin adapter with 3'-TGGN overhang enables highly specific selection of tRNAs with 3'-CCA end, rendering it a powerful tool to analyze the tRNA pool of cells under different conditions and for a variety of tRNA-related diseases. For validating Lotte-seq, tRNAs from HEK293T, S. oleracea, S. cerevisiae, D. discoideum, E. coli and G. stearothermophilus were sequenced using three different library preparation strategies (Standard Illumina sRNA TruSeq; Illumina sRNA TruSeq optimized for tRNAs and Lotte-seq). The purified library constructs were analyzed by a 2100 Bioanalyzer (Agilent) at the Max Planck Institute for evolutionary anthropology (MPI EVA Leipzig) for concentration and purity. High-throughput analysis of the libraries was done as single end run (150 nt) with a MiSeq System (Illumina®) at the MPI EVA (Leipzig) and a custom primer designed for Illumina MiSeq analysis (5'-CACTGTCGGTACCGAGCTTGCATGGAGTCCTA-3').
Sample: G.stearothermophilus opt. TruSeq rep1
SAMN11608904 • SRS4739216 • All experiments • All runs
Library:
Name: 20
Instrument: Illumina MiSeq
Strategy: RNA-Seq
Source: TRANSCRIPTOMIC
Selection: RT-PCR
Layout: SINGLE
Runs: 1 run, 2.8M spots, 279.2M bases, 117Mb
Run# of Spots# of BasesSizePublished
SRR90327092,800,115279.2M117Mb2019-07-31

ID:
7807662

Supplemental Content

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...