G. stearothermophilus Lotte-seq rep2 - SRA

Links from BioSample

SRX5809962: G. stearothermophilus Lotte-seq rep2
1 ILLUMINA (Illumina MiSeq) run: 2.5M spots, 249.8M bases, 92.1Mb downloads

Design: G. stearothermophilus cells were cultivated in medium 220 at 50°C. For total RNA isolation, Trizol was added to the disrupted cells. The hairpin-shaped DNA adapter with 3'-TGGN overhang (5'-pCGACACTGTCGGTACCGACGGGAGAAGTCGGTACCGACAGTGTCGTGGNp-3') were ligated. tRNA ligated at the 3'-end to the hairpin adapter was incubated with 32P-labeled RT primer (5'-CAAGC TCGGTACCGACAGTG-3'). The SuperScript IV RT were added. The cDNA was separated on a poly-acrylamide gel. The DNA-only version of the Illumina TruSeq small RNA kit adapter (5'-pGATCGTCGGACTGTAGAACTCTGAAC-AminoC6-3') was ligated to the gel-purified cDNA. cDNA carrying 5' and 3' adapter sequences was incubated and amplified with the Illumina 5' PCR primer for TruSeq small RNA (5'- AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGA-3') and a custom index primer (5'-CAAGCAGAAGACGGCATACGAGATNNNNNNTAGGACTCCATGCAAGCTCGGTACCGACAGTG-3'). High-throughput analysis of the libraries was done as single end run (150 nt) on a Illumina MiSeq System with the custom primer (5'-CACTGTCGGTACCGAGCTTGCATGGAGTCCTA-3').

Submitted by: University of Leipzig

Study: LOTTE-Seq: Highly specific selection of tRNAs with 3'-CCA end for high-throughput sequencing

PRJNA541863 • SRP197040 • All experiments • All runs

show Abstracthide Abstract

Currently available methods do not sample the entire tRNA pool or lack specificity for tRNAs. Combining and optimizing high-throughput sequencing methods, we developed Lotte-seq a highly specific protocol for efficient and comprehensive analysis of tRNAs. Ligation of a hairpin adapter with 3'-TGGN overhang enables highly specific selection of tRNAs with 3'-CCA end, rendering it a powerful tool to analyze the tRNA pool of cells under different conditions and for a variety of tRNA-related diseases. For validating Lotte-seq, tRNAs from HEK293T, S. oleracea, S. cerevisiae, D. discoideum, E. coli and G. stearothermophilus were sequenced using three different library preparation strategies (Standard Illumina sRNA TruSeq; Illumina sRNA TruSeq optimized for tRNAs and Lotte-seq). The purified library constructs were analyzed by a 2100 Bioanalyzer (Agilent) at the Max Planck Institute for evolutionary anthropology (MPI EVA Leipzig) for concentration and purity. High-throughput analysis of the libraries was done as single end run (150 nt) with a MiSeq System (Illumina®) at the MPI EVA (Leipzig) and a custom primer designed for Illumina MiSeq analysis (5'-CACTGTCGGTACCGAGCTTGCATGGAGTCCTA-3').

Sample: G.stearothermophilus Lotte-seq rep2

SAMN11608906 • SRS4739226 • All experiments • All runs

Organism: Geobacillus stearothermophilus

Library:

Name: 22

Instrument: Illumina MiSeq

Strategy: RNA-Seq

Source: TRANSCRIPTOMIC

Selection: RT-PCR

Layout: SINGLE

Runs: 1 run, 2.5M spots, 249.8M bases, 92.1Mb

Run	# of Spots	# of Bases	Size	Published
SRR9032696	2,497,749	249.8M	92.1Mb	2019-07-31

ID:: 7807672

SRA

Sequence Read Archive

Result Filters

Send to:

Links from BioSample

Supplemental Content

Related information

Recent activity