Instrument: Illumina HiSeq 2000
Strategy: OTHER
Source: TRANSCRIPTOMIC
Selection: other
Layout: SINGLE
Construction protocol: Cells were treated with lysozyme at RT for 5 min. Total RNA was extracted with hot acid phenol. The DMS-seq protocol (Rouskin et al. 2014) was adapted to detect RT stops in unmodified RNA. Poly(A)-selected RNA was denatured at 95°C for 2 minutes. 1X RNA-fragmentation reagent (Ambion) was added and mixed at 95°C for additional 1 minute before 20 mM EDTA was added to the mixture to stop the fragmentation. After ethanol precipitation, RNA fragments were dephosphorylated at their 3′ ends using T4 polynucleotide kinase (New England BioLabs). 60−80 nt RNA fragments were gel-purified and ligated to a pre-adenylated 3′ DNA adapter (AppTCGTATGCCGTCTTCTGCTTGddC). Products of the expected size (82−102 nt) were gel-purified and resuspended in 6 µl water. For reverse transcription, 1 µl 0.2 M Tris-Cl (pH 7.5), 1 µl 1.5 M KCl (or NaCl or LiCl), 0.5 µl 60 mM MgCl2, 0.5 µl 10 mM dNTP mix and 0.5 µl 1 µM 5′-radiolabeled primer (32p-NNNNNNGATCGTCGGACTGTAGAACTCTGAACCTGTCG/iSp18/CAAGCAGAAGACGGCATACG, in which N is any nucleotide, and iSp18 is an 18-atom hexa-ethyleneglycol spacer, IDT) were added to the RNA template. The mixture was incubated at 80°C for 2 minutes then cooled down to 42°C and incubated for additional 2 minutes before adding 100 U SuperScript III reverse transcriptase (Invitrogen). After incubation at 42°C for 10 minutes, the reaction was stopped with addition of 1 µl 1 M NaOH, and the mixture was heated at 98°C for 15 minutes to hydrolyze the RNA. cDNAs from extension that stalled after addition of 20−45 nt were separated from primers and full-length cDNAs on a 10% urea gel, eluted and precipitated. Purified cDNA fragments were circularized using 50 U CircLigase (Epicentre) at 60°C for 4 hours before inactivation at 80°C for 10 minutes. Circularized cDNAs were amplified using a 5′ indexed primer (AATGATACGGCGACCACCGACAGGTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACxxxxxxATCCGACAGGTTCAGAGTTCTACAGTCCGA, in which xxxxxx is the multiplexing index), a common 3′ primer (CAAGCAGAAGACGGCATACGA), and Platinum Taq DNA Polymerase High Fidelity (Invitrogen) for 10–13 cycles of PCR. Libraries were purified on an 8% formamide gel and sequenced on a HiSeq 2000 sequencing machine (Illumina; 40 cycles, single-end mode).