Instrument: NextSeq 550
Strategy: ATAC-seq
Source: GENOMIC
Selection: other
Layout: PAIRED
Construction protocol: To extract nuclei 50,000 mouse BMDCs were lysed in lysis buffer containing 10 mM Tris-HCl, pH 7.4, 10 mM NaCl, 3 mM MgCl2, 0.1% IGEPAL CA-630 Extracted nuclei is processed for tagmentation by adding 2.5 µL transposase in 25 µL of TD buffer and incubating the mixture at 37oC for 30 min using the Nextera DNA library prepare kit (Illumina FC-121-1030). Tagmented genomic DNA was purified using DNA clean and concentrator-25 columns (Zymo research D4033). Sequencing libraries were generated using the following forward (5'-aatgatacggcgaccaccgagatctacactcgtcggcagcgtcagatgtg-3') and barcoded reverse (5'- caagcagaagacggcatacgagat[8-bp barcode]gtctcgtgggctcggagatgt-3') primers, and by performing 12 cycles of amplification with the Q5 Hot Start High-Fidelity 2X Master Mix (New England Biolabs M0494) using the following cycling conditions: 1 cycle of 72oC for 5 min, 1 cycle of 98oC for 30 sec, 12 cycles of 98oC for 10 sec, 63oC for 30 sec, 72oC for 1 min, hold at 4oC. Libraries were purified using DNA clean and concentrator-25 columns (Zymo research D4033) to remove remaining primers, and amplicon size distributions measured using high sensitivity D5000 screentape (Agilent Technologies 5067-5592). Libraries were then quantified using the Qubit dsDNA High Sensitivity Assay Kit (ThermoFisher Scientific Q32851) and sequenced on the NextSeq550 platform (Illumina) using the NextSeq 500/550 high output kit v2 and following sequencing conditions: 42 cycles of Read 1, 8 cycles of Index 1, 42 cycles of Read 2.