Instrument: AB 5500xl Genetic Analyzer
Strategy: ChIP-Seq
Source: GENOMIC
Selection: ChIP
Layout: SINGLE
Construction protocol: Cells were suspended in 1 mL of phosphate buffered saline (PBS) and fixed by adding 27 mL of 36.5% formalin (Sigma) for 10 min at room temperature. Fixation was terminated by adding 110 mL of 1.5 mM glycine. The fixed cells were washed twice in PBS containing 0.1% bovine serum albmin (BSA), and were lysed in 400 mL SDS-lysis buffer [50 mM Tris-HCl (pH 8.0) containing 1% SDS, 10 uM EDTA, and 1 mM PMSF] on ice for 10 min. Chromatins were then solubilized using Bioruptor UCD250 with ice-chilled water, with 15 cycles of 30 sec sonication at the high power and 60 sec interval. The sonication products were centrifuged at 16,000 g for 5 min. The supernatants were diluted in 1 mL ChIP dilution buffer [16.7 mM Tris-HCl (pH 8.0), 0.01% SDS, 1.1% Triton X100, 1.2 mM EDTA, 167 mM NaCl, 1 mM SDS, 200 mg/mL tRNA (Roche)], and were divided into 0.1 mL as input DNA and 1.3 mL as ChIP samples. The ChIP samples were mixed with the Dynabeads-antibody complexes and rotated at 4 ºC overnight. The ChIP-ed Dynabeads were recovered using the DynaMag-2 magnet (Life Technologies), and washed with 200 mL of low salt buffer [20mM Tris-Cl (pH 8.0), containing 0.1% SDS, 1% Triton X100, 2 mM EDTA, and 150 mM NaCl], high salt buffer [20mM Tris-Cl (pH 8.0), containing 0.1% SDS, 1% Triton X100, 2 mM EDTA, and 500 mM NaCl], RIPA buffer [10mM Tris Cl (pH8.0), containing 1% Sodium deoxycholate, 1% NP40, 250 mM LiCl, and 1 mM EDTA], and TE buffer [10 mM Tris Cl (pH8.0), containing 1 mM EDTA]. The ChIP-ed Dynabeads were then incubated in new tubes containing 50 mL of Elution buffer (0.1 mM NaHCO3, 1% SDS, 10 mM DTT, and 0.06 mM tRNA) for 15 min at room temperature. The supernatants were collected using DynaMag-2, and were reverse-crosslinked by adding 8 mL of 2.5 M NaCl and incubating at 65 ºC overnight. Then, 2 mL of 0.5 M EDTA and 4 mL of 0.645 mg/mL proteinase K solution were added to reaction mixture, and further incubated at 45 ºC for 1 hr. The ChIP-ed DNAs were then purified with Qiaquick PCR purification columns, using the buffer EB supplemented with 4 ng/mL tRNA (Qiagen). The ChIP-ed and Input DNAs were sheared to an average size of about 150 bp by ultra-sonication (Covaris, Woburn, MA). ChIP-ed DNAs obtained from 1×106 cells were then subjected to the procedures for SOLiD Fragment Library Preparation (Life Technologies) according to the manufacture’s instruction except for the ligation reaction that was performed overnight. The libraries were amplified with 11-13 cycles of PCR for H3K4me3 and H3K27ac or 8 cycles for H3K9me2 and H3K27me3. ChIP-ed DNA for histone modifications from 1×105 cells were subjected to the procedures for SOLiD Fragment Library Preparation with a modification where the size fractionation step using AMPure XP beads (Agencourt) was omitted and ligation reaction was performed overnight. The libraries were amplified with 12-16 cycles of PCR for H3K27ac or 8 cycles for H3K9me2 and H3K27me3. We developed a new method to prepare and precisely amplify libraries of ChIPed DNA from a small number of cells, and applied this method to H3K4me3 from 1 x 105 cells and transcription factors from 3×105 ~ 1×106 cells. A modified adaptor for SOLiD library was prepared by annealing 50 mM each of P1-T Adaptor/F (CCACTACGCCTCCGCTTTCCTCTCTATGGGCAGTCGGTGAT) and Barcode-Internal+12mer/R (TCACCGACTGCCACGCCTTGGCCGTACAGCAGCCTCTTACACAGAG, with Phosphorylated 5'-end) in 1×Linker buffer [50 mM Tris-HCl (pH 8.0) containing 100 mM NaCl and 1 mM EDTA] with a step-wise cooling procedure (95 ºC, 70 ºC, 50 ºC, 40 ºC and 25 ºC for 15 min, respectively). The sheared DNAs were end-repaired using End-It DNA End-Repair Kit (Epicentre) in a 120 mL scale according to the manufacture’s instruction, and purified using MinElute PCR purification kit (Qiagen) with 540 mL of binding buffer PB3 (5.6 M Gu HCl, 33.3% isopropanol) supplemented with 10 ng/mL tRNA and 10 mL of elution buffer EB (Qiagen) with 4 ng/mL tRNA. The end-repaired DNAs were incubated in 20 mL of dA tailing mixture [0.2 mM dATP (GE Healthcare), 1×High Yield buffer (Greiner), 4 ng/mL tRNA 2.5 unit of Taq DNA polymerase (Greiner)], for 10 min at 70 ºC, and purified using MinElute PCR purification kit with buffers PB (Qiagen) and EB (11 mL) supplemented with tRNA. The dA-tailed DNAs were incubated in 15 mL ligation mixture [1×DNA Ligase Reaction Buffer (Life Technologies), 0.1 mM the modified adaptor, and 2.5 unit ExpressLink T4 DNA Ligase (Life Technologies)] at 16 ºC for more than 22 hr. The adaptor-ligated DNAs were then amplified using the Platinum Taq DNA Polymerase in a 50 mL reaction scale (Life Technologies) with 1 mM each of Library PCR primer 1 (Life Technologies) and Library PCR primer Barcode001+Internal adaptor (CTCTGTGTAAGAGGCTGCTGTACGGCC). PCR was performed with 8 cycles for ChIP-ed DNAs of H3K4me3 and with 10 cycles for those of EGFP-BLIMP1. PCR products were purified using 50 mL AMPure XP beads supplemented with 3.33 mL of 25% PEG8000 and 13.7 mL of 2.5 M NaCl, and eluted in 30 mL of buffer EB supplemented with tRNA. The PCR products were then subjected to another 5-cycle PCR using 1 mM each of Library PCR Primer 1 and P2-Barcode-N-Internal primer [CTGCCCCGGGTTCCTCATTCTCT (N10) CTGCTGTACGGCCAAGGCGT, where N10 corresponds to SOLiD barcode sequences other than barcode 1; e.g., AGGGAGTGGT for barcode 2], and purified twice with AMPure XP beads supplemented with PEG8000 and NaCl.