Instrument: Illumina MiSeq
Strategy: OTHER
Source: GENOMIC
Selection: other
Layout: PAIRED
Construction protocol: For infected single cells, the cells were lysed and DNA was kept suspended in the lysis buffer. For infected cell populations, genomic DNA was extracted using the QIAamp DNA mini kit (Qiagen) Phusion hot start II DNA polymerase (New England Biolabs) PCR reaction mix (10$ul 5 x Phusion HF buffer, 1ul dNTPs, 2.5ul of the forward primer, 2.5ul of the reverse primer, 0.5ul Phusion hot start II DNA polymerase, 2.5ul of DMSO and molecular biology grade water to 50ul reaction volume) was added to the lysed single cells or extracted genomic DNA of cell populations. Two rounds of PCR were performed. The first-round reaction amplified a region of the RT gene in the proviral DNA using the forward primer 5' tcgtcggcagcgtcagatgtgtataagagacagTTAATAAGAGAACTCAAGATTTC 3' and reverse primer 5' gtctcgtgggctcggagatgtgtataagagacagCCCCACCTCAACAGATGTTGTC 3'. Non-capitalized portion of the primers represent the Nextera XT Index Kit adaptors. Cycling program was 98C for 30 seconds, then 35 cycles of 98C for 10 seconds, 50C for 30 seconds and 72C for 15 seconds with a final extension of 72C for 5 minutes. 1$\mu l$ of the first round product was then transferred into a PCR mix as above, with second round Nextera XT Index Kit adaptor primers (forward 5' tcgtcggcagcgtcagatgtgtataagagacag 3', reverse 5' gtctcgtgggctcggagatgtgtataagagacag 3'). The second round PCR amplified a 400bp product which was then visualized on a 1% agarose gel. The PCR amplicon was gel extracted using the QIAquick gel extraction kit (Qiagen). Illumina indices were attached to the amplicon with the Nextera XT Index Kit and deep sequenced using the Illumina Miseq. Fast-q files were analysed in Geneious. amplicon sequencing using illumina MiSeq with adaptors from Nextera kit