Instrument: Illumina HiSeq 2500
Strategy: RNA-Seq
Source: TRANSCRIPTOMIC
Selection: cDNA
Layout: PAIRED
Construction protocol: Cell suspensions were resuspended in PBE and incubated on ice for 30 min with fluorescently-labeled antibodies (Table S2) along with 1 mg/mL of anti-CD16/32 (24G2, eBioscience). For detection of cells in early S of the cell cycle, we performed dual nucleotide pulse and staining as previously described (Gitlin et al., 2014). Briefly, mice were injected i.v. with 1 mg of EdU (A10044, Thermo Fisher Scientific) and one hour later with 2 mg of BrdU (B5002, Sigma). 30 min after the second injection, lymph nodes were harvested, and single cell suspensions were prepared. After cell surface receptor staining as described above, cells were fixed and permeabilized using BD Cytofix/Cytoperm™ fixation and permeabilization solution and BD Cytoperm Permeabilization Buffer PLUS, respectively. EdU and BrdU incorporation into DNA was assayed using the Click-iT Plus EdU Alexa Fluor 647 Flow Cytometry Assay Kit (Invitrogen) and FITC BrdU Flow Kit (BD), respectively. For single cell sorting, cells were stained as above and index-sorted directly into 96 well plates containing Buffer TCL (Qiagen) supplemented with 1% -mercaptoethanol using a BD FACS Aria II. Each plate contained all conditions assayed in each replicate. Cells were washed, filtered, and resuspended in PBE prior to analysis or sorting on BD FACS LSR II, FACS Symphony or FACS ARIA II cytometers. All data were analyzed using Flowjo software v.10. Libraries were prepared as previously described (Trombetta et al., 2014). Briefly, nucleic acids were extracted from sorted single cell using RNAClean XP SPRI beads (Beckman Coulter), and RNA was hybridized first using RT primer (/5BiosG/AAGCAGTGGTATCAACGCAGAGTACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN) then reverse-transcribed into cDNA using TSO primer (AAGCAGTGGTATCAACGCAGAGTACATrGrGrG) and RT maxima reverse transcriptase (Thermo Fisher Scientific). cDNA was amplified using ISPCR primer (AAGCAGTGGTATCAACGCAGAGT) and KAPA HiFi HotStart ReadyMix (Fisher Scientific), cleaned up using RNAClean XP SPRI beads three times, and tagmented using Nextera XT DNA Library Preparation Kit (Illumina). For each sequencing batch, up to four plates were barcoded at a time with Nextera XT Index Kit v2 Sets A-D (Illumina). Finally, dual-barcoded libraries were pooled and sequenced using Illumina Hiseq2500 (experiment 1)/Nextseq 550 (experiments 2-4) platform. Smartseq2