GSM132593[Accession] - GEO DataSets

Warning: The NCBI web site requires JavaScript to function. more...

Format

Summary
Summary (text)
Unique Identifier List

Sort by

Default order
Number of Samples (High to Low)
Number of Samples (Low to High)

Send to:

Choose Destination

File
Clipboard
Collections

Search results

Items: 3

Select item 2000063141.

Temporal and Spatial Transcriptional Profiles of Aging in Drosophila

(Submitter supplied) Genetic analyses suggest that alterations in gene expression at the molecular and tissue levels can have profound effects on aging for multi-cellular organisms. However, much remains unknown about the normal pattern of genetic changes in different tissues and how these tissues interact during aging. To investigate tissue-specific aging systematically, we measured expression profiles of aging in Drosophila melanogaster in seven tissues representing nervous, muscular, digestive, renal, reproductive, and storage systems. more...

Organism:: Drosophila melanogaster

Type:: Expression profiling by array

Platform:: GPL4225
70 Samples

Download data

Series

Accession:: GSE6314

ID:: 200006314

PubMed Full text in PMC Similar studies Analyze with GEO2R

Select item 1000042252.

Drosophila microarray sheet

(Submitter supplied) PCR products of 14,151 predicted or known genes in D. melanogaster were used to generate DNA microarray. The length of each PCR amplicon was 100-600 bp. cDNA was amplified with universal primers (AATGCAGGTTAACCTGGCTTATCG and AACGCGGCTACAATTAATACATAACC). PCR products were printed on 3-D slides (Full Moon Biosystems Inc.).