PCR was used to amplify a fragment corresponding to each predicted ORF of the genome. BLAST was used to design primer pairs that generate products that do not crosshybridize to other genes in the M. tuberculosis H37Rv genome. Primer pairs were found for 3,855 predicted ORFs. PCR products varied in length from 70 bp to 499 bp, with a median length of ~350 bp. Forward and reverse primers contained 5' extensions: GGCATCTAGAG and CCGCACTAGTCCTC, respectively. PCRs with these gene-specific primers were performed by using 1.25 units of Taq and 0.15 units of Pfu polymerase (Stratagene) in 50 ml reactions containing 2.5 mM MgCl2, 10% (vol/vol) DMSO and H37Rv genomic DNA as template. PCR conditions were 94°C for 2 min; 30 cycles of 94°C for 30 sec, 60°C for 30 sec, 72°C for 1 min; and 72°C for 5 min. First round PCR products were diluted 1:100, and 2.5 microliters were used as a template for PCR with the following universal primers (both contain 5' amino modifications including a three-carbon linker; Genosys, The Woodlands, TX): GAACCGATAGGCATCTAGAG and GAAATCCACCGCACTAGTCCTC. PCR was performed as follows: 94°C for 2 min; 3 cycles of 94°C for 30 sec, 40°C for 30 sec, 72°C for 1 min; 20 cycles of 94°C for 30 sec, 60°C for 30 sec, 72°C for 1 min; and 72°C for 5 min. Second round PCR products were analyzed by gel electorphoresis on 2% agarose gels. PCR of all but 11 ORFs produced single products. Those reactions that did not produce products of appropriate size or produced multiple products were not included in further analysis. PCR products were purified by using multiscreen PCR plates (Millipore). PCR products were arrayed onto 3D-Link slides (Surmodics, Eden Prairie, MN) in duplicate, as recommended by the manufacturer.
Less...
More...