|
|
GEO help: Mouse over screen elements for information. |
|
Status |
Public on Dec 12, 2013 |
Title |
Whole Genome Shotgun Bisulfite Sequencing of Bladder Cells from Human STL001; methylC-seq_STL001BL-01a |
Sample type |
SRA |
|
|
Source name |
Bladder tissue; methylC-seq_STL001BL-01a
|
Organism |
Homo sapiens |
Characteristics |
sample alias: STL001BL-01 sample common name: Bladder molecule: genomic DNA disease: None biomaterial_provider: Shin Lin, Stanford University biomaterial_type: Primary Tissue tissue_type: Bladder tissue_depot: N/A collection_method: Autopsy donor_id: STL001 donor_age: 3 donor_health_status: healthy, no prior medical history (NO diabetes, hypertension, coronary artery disease, cancer) donor_sex: Male donor_ethnicity: Caucasian and African American experiment_type: DNA Methylation extraction_protocol: Qiagen DNeasy mini kit, performed as per manufacturer's instructions extraction_protocol_type_of_sonicator: Covaris S2 extraction_protocol_sonication_cycles: 200 bp, 3 cycles dna_preparation_initial_dna_qnty: 1 µg dna_preparation_fragment_size_range: 200 dna_preparation_adaptor_sequence: A: 5' P-GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG, B: 5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT dna_preparation_adaptor_ligation_protocol: 16degC for 16 hours with T4 DNA ligase (New England Biolabs) dna_preparation_post-ligation_fragment_size_selection: Two rounds of purification with AMPure XP beads (Agencourt) bisulfite_conversion_protocol: Invitrogen MethylCode bisulfite_conversion_percent: 99.5% of cytosines converted based on shotgun sequencing of unmethylated lambda phage control spiked into original genomic DNA sample library_generation_pcr_template_conc: >The adapter-ligated, bisulfite converted DNA was used in a 50 µl PCR reaction library_generation_pcr_polymerase_type: KAPA HiFi HotStart Uracil+ ReadyMix library_generation_pcr_thermocycling_program: 95degC 2 min; 98degC 30 sec, 4 cycles of 98degC 15 sec, 60degC 30 sec, 72degC 4 min; 72degC 10 min library_generation_pcr_number_cycles: 4 library_generation_pcr_f_primer_sequence: 5' AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT library_generation_pcr_r_primer_sequence: 5' CAAGCAGAAGACGGCATACGAGCTCTTCCGATCT library_generation_pcr_primer_conc: 25 µM library_generation_pcr_product_isolation_protocol: Two rounds of purification with AMPure XP beads (Agencourt)
|
Extracted molecule |
genomic DNA |
Extraction protocol |
Library construction protocol: One µg of genomic DNA was extracted from frozen ground tissue using the DNeasy Mini Kit (Qiagen, Valencia, CA) and spiked with 25 ng unmethylated cl857 Sam7 Lambda DNA (Promega, Madison, WI). The DNA was fragmented with a Covaris S2 (Covaris, Woburn, MA) to 200 bp, followed by end repair and addition of a 3'A base. Cytosine-methylated adapters provided by Illumina (Illumina, San Diego, CA) were ligated to the sonicated DNA at 16degC for 16 hours with T4 DNA ligase (New England Biolabs). Adapter-ligated DNA was isolated by two rounds of purification with AMPure XP beads (Beckman Coulter Genomics, Danvers, MA). Adapter-ligated DNA (450 ng) was subjected to sodium bisulfite conversion using the MethylCode kit (Life Technologies, Carlsbad, CA) as per manufacturer's instructions. The bisulfite-converted, adapter-ligated DNA molecules were enriched by 4 cycles of PCR with the following reaction composition: 25 µl 2x KAPA HiFi HotStart Uracil+ReadyMix, 2.5 µl Primer 1, 2.5 µl Primer 2 (50 µl final). The thermocycling parameters were: 95degC 2 min, 98degC 30 sec, then 4-8 cycles of 98degC 15 sec, 60degC 30 sec and 72degC 4 min, ending with one 72degC 10 min step. The reaction products were purified using AMPure XP beads (two rounds). Up to three separate PCR reactions were performed on subsets of the adapter-ligated, bisulfite-converted DNA, yielding up to two independent libraries from the same biological sample.
|
|
|
Library strategy |
Bisulfite-Seq |
Library source |
genomic |
Library selection |
RANDOM |
Instrument model |
Illumina HiSeq 2000 |
|
|
Description |
sample_term_id: UBERON_0001255 assay_term_id: OBI_0001863 nucleic_acid_term_id: SO_0000352 Design description: Whole Genome Shotgun Bisulfite Sequencing of Bladder Cells from Human STL001 Library name: methylC-seq_STL001BL-01a EDACC Genboree Experiment Page: http://genboree.org/java-bin/project.jsp?projectName=XML%20Submissions%2FUCSD%2FEXPERIMENT%2FEDACC.14779 EDACC Genboree Sample Page: http://genboree.org/java-bin/project.jsp?projectName=XML%20Submissions%2FUCSD%2FSAMPLE%2FEDACC.14777 **************** For data usage terms and conditions, please refer to: http://www.drugabuse.gov/funding/funding-opportunities/nih-common-fund/epigenomics-data-access-policies ****************
|
Data processing |
Various levels of processed data files will be made available as this project proceeds.
|
|
|
Submission date |
Dec 28, 2012 |
Last update date |
May 15, 2019 |
Contact name |
UCSD AND SALK |
Organization name |
University of California, San Diego
|
Street address |
Health Sciences Drive
|
City |
La Jolla |
State/province |
CA |
ZIP/Postal code |
92092 |
Country |
USA |
|
|
Platform ID |
GPL11154 |
Series (1) |
GSE16256 |
UCSD Human Reference Epigenome Mapping Project |
|
Relations |
SRA |
SRX213279 |
BioSample |
SAMN01881275 |
Supplementary data files not provided |
SRA Run Selector |
Raw data are available in SRA |
|
|
|
|
|