 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Mar 06, 2014 |
| Title |
GFP_RNAi_MNase_AB_(20120606_77_12_5) |
| Sample type |
SRA |
| |
|
| Source name |
MNased chromatin
|
| Organism |
Drosophila melanogaster |
| Characteristics |
cell line: S2
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
Drosophila S2-DRSC cells were obtained from the Drosophila Genomics Resource Center (Stock #181) and only passages 10-20 were used for experiments. Cells were cultured in Schneider's media supplemented with 10% heat inactivated FBS at 25 degrees C, with an ~30hr doubling time. dsRNA was synthesized using NEB reagents and protocols from PCR templates containing the T7 promoter sequence. PCR primers were as follows: H2Av Forward (5'- TAATACGACTCACTATAGGGCGAAACCGAATTCCGTAGAA - 3') H2Av Reverse (5- TAATACGACTCACTATAGGGAGTAGGCCTGCGACAGA -3'), and GFP control (PMID: 16204180). To administer dsRNA, 2.5 x 10^6 log phase cells / cm^2 surface area were brought up in Schneider's without FBS (0.1mL/cm^2) and seeded in 25cm^2 flasks. 30microg dsRNA/1x10^6 cells was incubated with cells for 1 hour with intermittent mixing. After incubation with dsRNA, an equal volume of Schneider's with 20% FBS was added and cells were grown for 96 hours before harvesting. Cells were pelleted 2' at 600 x g, washed with 5mL RT PBS, and centrifuged 2' at 600 x g. Cells were resuspended in 1.9mL ice cold HM2 (10mM Hepes pH 7.4, 2mM MgCl2, 0.5mM PMSF), incubated 2' on ice, and lysed with 0.6% NP-40 with intermittent pipetting for 5' on ice. Nuclei were centrifuged 10' at 100 x g at 4°C and washed with 1mL HM2 and centrifuged 5' at 100 x g at 4 degrees C. Nuclei were brought up in 150microl HM2, warmed to 37 degrees C for 2', CaCl2 was added to 1mM, and digested with 0.066U MNase. 50 microl aliquots were taken out and terminated with 5mM EDTA on ice after 5', 10', and 15'. Time-points that were similarly digested to mostly mononucleosomes (~80%) were sequenced using a protocol similar to PMID: 22025700 with modifications. We used the TruSeq oligo design to enable barcoding of libraries and modified AMPure XP to sample ratio to 1:1 to accommodate longer adapter sequences. Biological replicates were sequenced for each condition.
|
| |
|
| Library strategy |
MNase-Seq |
| Library source |
genomic |
| Library selection |
MNase |
| Instrument model |
Illumina HiSeq 2000 |
| |
|
| Description |
Chromatin digested to mostly mononucleosomes (~80%) from cells treated with dsRNA targeting GFP. Replicates A and B.
|
| Data processing |
1. We used Bowtie (0.12.7 - Sep 7 2010) to map paired-end 25bp reads to release r5.30 (Jul 2010) of the D.melanogaster genomic sequence obtained from FlyBase. If a read was mapped to multiple locations, one location was picked at random 2. We extracted properly paired reads (Supplementary files .bed) 3. For each base pair in the genome, we counted the number of paired-end fragments aligned over it. 4. We normalized base pair counts by dividing by the total number of counts for all base pairs and then multiplying by the total number of base pairs in the genome. 5. We selected insert fragments 76-150 base pairs in length, repeated steps 3. and 4. and made a combined file of two replicates (Supplementary file AB.wig).
|
| |
|
| Submission date |
Jul 22, 2013 |
| Last update date |
May 15, 2019 |
| Contact name |
Jorja Henikoff |
| E-mail(s) |
jorja@fhcrc.org
|
| Phone |
206-667-4850
|
| Organization name |
Fred Hutchinson Cancer Research Center
|
| Department |
Basic Sciences
|
| Lab |
Henikoff
|
| Street address |
1100 Fairview AV N, A1-162
|
| City |
Seattle |
| State/province |
WA |
| ZIP/Postal code |
98109-1024 |
| Country |
USA |
| |
|
| Platform ID |
GPL13304 |
| Series (1) |
| GSE49106 |
Nucleosomes are context-specific, H2A.Z modulated barriers to RNA polymerase |
|
| Relations |
| BioSample |
SAMN02261670 |
| SRA |
SRX326991 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM1193876_GFP_RNAi_MNase_A.bed.gz |
221.8 Mb |
(ftp)(http) |
BED |
| GSM1193876_GFP_RNAi_MNase_AB.wig.gz |
52.7 Mb |
(ftp)(http) |
WIG |
| GSM1193876_GFP_RNAi_MNase_B.bed.gz |
123.5 Mb |
(ftp)(http) |
BED |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
