 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on May 30, 2014 |
| Title |
MandIL4_2 |
| Sample type |
SRA |
| |
|
| Source name |
Macrophages, IL4
|
| Organism |
Mus musculus |
| Characteristics |
strain: C57BL/6
cell type: bone-marrow derived macrophages
|
| Extracted molecule |
polyA RNA |
| Extraction protocol |
Bone-marrow derived macrophages were generated from C57BL/6 mice and stimulated with either Il4 or combination of LPS&IFNg or left unstimulated for 24 h
mRNA was extracted from cell lysates using oligo-dT beads (Invitrogen). For cDNA synthesis, we used custom oligo-dT primer with a barcode and adapter-linker sequence (CCTACACGACGCTCTTCCGATCT—XXXXXXXX-T15). After first strand synthesis samples were pooled together based on Actb qPCR values and RNA-DNA hybrids were degraded using consecutive acid-alkali treatment. Then, second sequencing linker (AGATCGGAAGAGCACACGTCTG) was ligated using T4 ligase (New EnglandBiolabs, Ipswich, MA) and after SPRI clean-up, mixture was PCR enriched 14 cycles andSPRI purified to yield final strand specific 3'end RNA-seq libraries
3'end DGE
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina HiSeq 2500 |
| |
|
| Description |
Barcode: GTATAACA
|
| Data processing |
Data were sequenced on HiSeq 2500 instrument (Illumina, San Diego, CA) using 50bpX25bp pair-end sequencing. Second mate was used for sample demultiplexing, at which point individual single-end (demultiplexed) fastqs were aligned to mm9 genome using TopHat with following options -G mm9.mrna.10.31.gtf --prefilter-multihits --segment-length 20 --max-multihits 15. Geneexpression was obtained using ESAT software tool (http://garberlab.umassmed.edu/software/esat/) focused on analysis of 3’end targetedRNA-Seq. The following parameters were used: -task "score3P" –normalizedOutput -window 1000 -maxExtension 3000 -maxIntoGene 2000 -stranded –collapseIsoforms.
Genome_build: mm9
Supplementary_files_format_and_content: tab delimited file that includes normalized expression data
|
| |
|
| Submission date |
Dec 06, 2013 |
| Last update date |
May 15, 2019 |
| Contact name |
Maxim N. Artyomov |
| E-mail(s) |
martyomov@pathology.wustl.edu
|
| Organization name |
Washington University in St.Louis
|
| Department |
Immunology&Pathology
|
| Street address |
660 S. Euclid Avenue, Campus Box 8118
|
| City |
St.Louis |
| State/province |
MO |
| ZIP/Postal code |
63110 |
| Country |
USA |
| |
|
| Platform ID |
GPL17021 |
| Series (1) |
| GSE53053 |
High-throughput integration of metabolic and transcriptional profiles reveals major metabolic regulators of macrophage polarization |
|
| Relations |
| Reanalyzed by |
GSE80797 |
| BioSample |
SAMN02437457 |
| SRA |
SRX387839 |
| Supplementary data files not provided |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data are available on Series record |
|
|
|
|
 |
