|
| Status |
Public on Jul 02, 2014 |
| Title |
ICM08_LVimp_1 |
| Sample type |
SRA |
| |
|
| Source name |
failing ICM left-ventricular myocardium, before LVAD support
|
| Organism |
Homo sapiens |
| Characteristics |
age: 54
gender: Male
race: Caucasian
tissue: Cardiac Muscle
disease: Ischemic Cardiomyopathy
heart failure onset: 2008
nyha: 4
ejection fraction: 13
lvad status: No LVAD
lvad device: HeartMate II
days lvad: NA
pacemaker: Yes
pacemaker: Yes
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Total RNA was isolated using a modified TRIzol protocol including another acidic phenol chloroform extraction followed by ethanol precipitation; the myocardial samples were additionally treated by DNase I treatment and proteinase K digestion in the presence of 0.5 % SDS, and recovered by two ethanol precipitations. Total RNA from liquid specimen was isolated using TRIzol LS, followed by a 2-propanol precipitation in the presence of glycogen, a proteinase K digestion (f.c. 100 µg/ml in 0.5 % SDS for 20 min at 42 degrees C), another acidic phenol-chloroform extraction, and two ethanol precipitations.
The small RNA libraries for the solid tissue samples were prepared using the protocol described in Hafner et al. (2008, 44:3, 2012, 58:164). The libraries for for the serum and plasma samples had the following modifications: 1) the amount of the 10 spiked-in synthetic calibrator oligoribonucleotides was reduced from 0.5 fmol each per 2 µg total RNA input to 0.005 fmol each, 2) the synthetic P32-labeled 19-nt and 24-/35-nt ssRNAs used for size selection were not spiked-into the samples. Note: no calibrator oligoribonucleotides were spiked-in to library 8. The sequences of the 10 used calibrator oligoribonucleotides can be obtained from Hafner et al. 2012 (Methods, 58:164).
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
size fractionation |
| Instrument model |
Illumina Genome Analyzer IIx |
| |
|
| Description |
Sample name: ICM08_LVimp_1
Processed data file: tissue_clusters.txt
Processed data file: tissue_seqfams.txt
Processed data file: tissue_unique.txt
Library: 3
barcode: TCCAC
common 3'-adapter: TCGTATGCCGTCTTCTGCTTG
complete 3'-adapter: TCCACTCGTATGCCGTCTTCTGCTTG
|
| Data processing |
Base calling was done using CASAVA versions 1.6 - 1.8.2.
The data was processed as described in Brown et al. (2013, Front Genet, 4:145) using a curated miRNA (Farazi et al. 2011, 71:4443) and other non-coding and coding RNA transcriptomes.
Genome_build: GRCh37/hg19
Supplementary_files_format_and_content: The processed data files contain raw, i.e. not-normalized or transformed, miRNA counts based on unique miRNA sequences, or based on precursor clusters and sequence families.
|
| |
|
| Submission date |
Dec 06, 2013 |
| Last update date |
May 15, 2019 |
| Contact name |
Kemal Marc Akat |
| E-mail(s) |
kakat@rockefeller.edu
|
| Phone |
212-327-7645
|
| Organization name |
The Rockefeller University
|
| Lab |
Laboratory of RNA Molecular Biology, Thomas Tuschl
|
| Street address |
1230 York Avenue
|
| City |
New York |
| State/province |
NY |
| ZIP/Postal code |
10065 |
| Country |
USA |
| |
|
| Platform ID |
GPL10999 |
| Series (2) |
| GSE53080 |
Comparative RNA-sequencing analysis of myocardial and circulating small RNAs in human heart failure and their utility as biomarkers [small RNA-seq] |
| GSE53081 |
Comparative RNA-sequencing analysis of myocardial and circulating small RNAs in human heart failure and their utility as biomarkers |
|
| Relations |
| BioSample |
SAMN02437754 |
| SRA |
SRX388335 |
