|
|
GEO help: Mouse over screen elements for information. |
|
Status |
Public on Apr 20, 2015 |
Title |
WT-2_D4(RA) |
Sample type |
SRA |
|
|
Source name |
46C mES cells (RA, Day4)
|
Organism |
Mus musculus |
Characteristics |
cell line: 46C cell type: embryonic stem cells genotype/variation: WT treatment: LIF withdrawal, 2uM RA-induced differentiation time: day4 strain: 129/Ola
|
Growth protocol |
ESCs were cultured in N2B27 complete "2i" medium including: 100 ml DMEM/F12 basal medium (Life Technologies), 100 ml Neurobasal medium (Life Technologies), 1 ml N2 supplement (Life Technologies), 2 ml B27 supplement (Life Technologies), 1 ml 100 × Glutamax (Life Technologies) and 0.1 mM 2-mercaptoethanol, 1000U/ml recombinant leukemia inhibitory factor (LIF, millipore) and "2i" (1 uM PD03259010, 3 uM CHIR99021) for one day. The cells were then passaged with N2B27 medium without LIF or "2i", and supplemented with 2 uM retinoic acid (RA), change medium everyday. Cells were harvested at day 4 of RA-induced differentiation
|
Extracted molecule |
total RNA |
Extraction protocol |
Cells were harvested at day 4 of RA-induced differentiation. TRIzol reagent was added directly into the plate after cold 1 × PBS wash once. The total RNA was extracted according to manufacturer's instructions. mRNA was further isolated by Dynabeads mRNA purification kit (Life Technologies) according to manufacturer's instructions. The library was constructed by library preparation modules (New England Biolabs) according to manufacturer's instructions. Briefly, mRNA was fragmentated by NEBNext Magnesium RNA Fragmentation Module at 94 ℃ for 5 min. The fragementated RNA was reverse transcribed by SuperScript III First-Strand Synthesis System for RT-PCR kit (Life Technology), 2'nd strand was then synthesized by NEBNext mRNA Second Strand Synthesis Module , the end repair, dA-tailing and adaptor ligation were also following the instruments by respect module. the adaptor for the libary was sythersized from IDT with the first 7nt is "GATGTCT" as a barcode. After liagation, the DNA was amplified by primer 1.0 (AATGATACGGCGACCACCGAGATCTACAC, synthersized from IDT) and 2.0 (CAAGCAGAAGACGGCATACGAGAT, synthersized from IDT) for 15 cycles. After this, the product was further purified and size selected by Ampure XP beads (Beckman Coulter). The library was sequenced on the Illumina instrument following the manufacturer's protocols.
|
|
|
Library strategy |
RNA-Seq |
Library source |
transcriptomic |
Library selection |
cDNA |
Instrument model |
Illumina HiSeq 1500 |
|
|
Description |
Sample 18 messenger RNA processed data file: mRNA profiling_Haunt 58 kb KO_RA differentiation.txt barcode: GATGTCT Sample 18
|
Data processing |
The sequencing company provided "clean reads" (i.e., low quality reads removed). Basecalls performed using CASAVA version ChIRP retrived DNA-Seq reads were aligned to the mm9 genome assembly using Bowtie version 1.0.0 with the default parameters RNA-seq reads were aligned to the mm9 genome assembly using Tophat v2.0.11,allowing for uniquely mapped reads and mapping both spliced and unspliced reads. FPKM was calculated by Cufflink 2.1.1 Peaks of each sample were called using MACS v. 1.4.2 Genome_build: mm9 Supplementary_files_format_and_content: RNA-seq: tab-delimited text files include FPKM values for wild-type or Haunt KO Samples; ChIRP-seq: bedgraph files were generated using MACS v. 1.4.2, including peaks called by default parameters.
|
|
|
Submission date |
Jun 16, 2014 |
Last update date |
May 15, 2019 |
Contact name |
jinlong lu |
E-mail(s) |
bioyuyang@hotmail.com
|
Phone |
5853098469
|
Organization name |
University of Rochester
|
Lab |
Gorbunova & Seluanov Labs
|
Street address |
213 Hutchinson Hall
|
City |
Rochester |
State/province |
NY |
ZIP/Postal code |
14627 |
Country |
USA |
|
|
Platform ID |
GPL18480 |
Series (1) |
GSE58514 |
Opposing roles for the lncRNA Haunt and its genomic locus in regulating HOXA gene activation during embryonic stem cell differentiation |
|
Relations |
BioSample |
SAMN02863132 |
SRA |
SRX644386 |
Supplementary data files not provided |
SRA Run Selector |
Raw data are available in SRA |
Processed data are available on Series record |
|
|
|
|
|