|
| Status |
Public on Nov 13, 2014 |
| Title |
GFP_Sus_A15 |
| Sample type |
SRA |
| |
|
| Source name |
Nucleus accumbens tissue
|
| Organism |
Mus musculus |
| Characteristics |
strain: C57BL/6
treatment: AAV GFP, Susceptible
|
| Treatment protocol |
10 day chronic social defeat stress
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Small RNA (<200bp) was first isolated and enriched with Qiagen RNeasy mini kit (Cat# 74104)
Epicentre Scriptminer small RNA library kit (Cat# SMSP10908)
the di-tagged cDNA was amplified and individually barcoded with nine cycle PCR cycles using indices and PCR primers provided in the kit. The library was then purified with Zymo DNA Clean & Concentrator kit (Cat# D4003) and size selected with Pippin
|
| |
|
| Library strategy |
ncRNA-Seq |
| Library source |
transcriptomic |
| Library selection |
size fractionation |
| Instrument model |
Illumina HiSeq 2500 |
| |
|
| Data processing |
name: cutadapt; version: 1.4.2; parameters: "-m 16 -q 20 -n 2 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC"
name: groupReads.pl (script in miRanalyzer package); version: 0.3; parameters: "input=input.fastq output=output.rc.txt"
Genome_build: mm9
Supplementary_files_format_and_content: read count table for adapter-trimmed small RNA
|
| |
|
| Submission date |
Sep 10, 2014 |
| Last update date |
May 15, 2019 |
| Contact name |
Li Shen |
| E-mail(s) |
li.shen@mssm.edu
|
| Organization name |
Icahn School of Medicine at Mount Sinai
|
| Department |
Neuroscience
|
| Lab |
Shen
|
| Street address |
1425 Madison Ave
|
| City |
New York |
| State/province |
NY |
| ZIP/Postal code |
10029 |
| Country |
USA |
| |
|
| Platform ID |
GPL17021 |
| Series (2) |
| GSE61295 |
b-Catenin Mediates the Development of Behavioral Resilience [smallRNA-Seq] |
| GSE61296 |
b-Catenin Mediates the Development of Behavioral Resilience |
|
| Relations |
| BioSample |
SAMN03031648 |
| SRA |
SRX698942 |
