NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM1635510 Query DataSets for GSM1635510
Status Public on Sep 01, 2015
Title dcl4-3 (rep1)
Sample type SRA
 
Source name imbibed kernels
Organism Zea mays
Characteristics age: 24 hr imbibed seed
tissue: embryo
background: B73
Growth protocol mature kernels were imbibed for 24 hrs in water, then embryos were dissected and flash frozen in liquid nitrogen
Extracted molecule total RNA
Extraction protocol Total RNA was extracted from embryos of 24 hr imbibed kernels using TRIzol reagent (Invitrogen). Small RNA libraries were prepared from 1 μg of total RNA using the NEBNext Multiplex Small RNA Library Prep Set for Illumina (New England Biolabs)
RNA libraries were prepared for sequencing using standard Illumina protocols
 
Library strategy ncRNA-Seq
Library source transcriptomic
Library selection size fractionation
Instrument model Illumina HiSeq 2000
 
Description small RNA
Data processing The RNA adapter AGATCGGAAGAGCACACGTCT was removed from the 3' end, keeping trimmed reads greater than 15 nt
trimmed reads 18- to 26-nt in length were aligned to the maize B73 RefGen_v2 genome (release 5a.57) using Bowtie v1.0.0 (Langmead et al. 2009), allowing no mismatches and up to 20 potential alignments per read
Reads matching known structural RNAs (rRNAs, tRNAs, sn-RNAs and sno-RNAs) from Rfam 10.0 (Griffiths-Jones et al. 2005) were removed from further analysis
Read counts were normalized by millions of mapped reads in each library (reads per million) for comparisons across samples.
Genome_build: B73 RefGen_v2 genome (release 5a)
Supplementary_files_format_and_content: tab-delimited txt files with normalized (rpm) small RNA abundance (21-24nt) for ta-siRNA, tasiR-ARF and siRNA derived from arf3 loci
 
Submission date Mar 17, 2015
Last update date May 15, 2019
Contact name Marja Timmermans
E-mail(s) timmerma@cshl.edu
Organization name Cold Spring Harbor Laboratory
Department Plant Biology
Lab Timmermans
Street address 1 Bungtown Rd
City Cold Spring Harbor
State/province NY
ZIP/Postal code 11724
Country USA
 
Platform ID GPL15463
Series (1)
GSE66986 Novel DICER-LIKE1 siRNAs Bypass the Requirement for DICER-LIKE4 in Maize Development
Relations
BioSample SAMN03421114
SRA SRX957839

Supplementary file Size Download File type/resource
GSM1635510_dcl4-3_rep1.txt.gz 213 b (ftp)(http) TXT
SRA Run SelectorHelp
Raw data are available in SRA
Processed data provided as supplementary file

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap