|
| Status |
Public on Sep 01, 2015 |
| Title |
dcl4-3 (rep2) |
| Sample type |
SRA |
| |
|
| Source name |
imbibed kernels
|
| Organism |
Zea mays |
| Characteristics |
age: 24 hr imbibed seed
tissue: embryo
background: B73
|
| Growth protocol |
mature kernels were imbibed for 24 hrs in water, then embryos were dissected and flash frozen in liquid nitrogen
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Total RNA was extracted from embryos of 24 hr imbibed kernels using TRIzol reagent (Invitrogen). Small RNA libraries were prepared from 1 μg of total RNA using the NEBNext Multiplex Small RNA Library Prep Set for Illumina (New England Biolabs)
RNA libraries were prepared for sequencing using standard Illumina protocols
|
| |
|
| Library strategy |
ncRNA-Seq |
| Library source |
transcriptomic |
| Library selection |
size fractionation |
| Instrument model |
Illumina HiSeq 2000 |
| |
|
| Description |
small RNA
|
| Data processing |
The RNA adapter AGATCGGAAGAGCACACGTCT was removed from the 3' end, keeping trimmed reads greater than 15 nt
trimmed reads 18- to 26-nt in length were aligned to the maize B73 RefGen_v2 genome (release 5a.57) using Bowtie v1.0.0 (Langmead et al. 2009), allowing no mismatches and up to 20 potential alignments per read
Reads matching known structural RNAs (rRNAs, tRNAs, sn-RNAs and sno-RNAs) from Rfam 10.0 (Griffiths-Jones et al. 2005) were removed from further analysis
Read counts were normalized by millions of mapped reads in each library (reads per million) for comparisons across samples.
Genome_build: B73 RefGen_v2 genome (release 5a)
Supplementary_files_format_and_content: tab-delimited txt files with normalized (rpm) small RNA abundance (21-24nt) for ta-siRNA, tasiR-ARF and siRNA derived from arf3 loci
|
| |
|
| Submission date |
Mar 17, 2015 |
| Last update date |
May 15, 2019 |
| Contact name |
Marja Timmermans |
| E-mail(s) |
timmerma@cshl.edu
|
| Organization name |
Cold Spring Harbor Laboratory
|
| Department |
Plant Biology
|
| Lab |
Timmermans
|
| Street address |
1 Bungtown Rd
|
| City |
Cold Spring Harbor |
| State/province |
NY |
| ZIP/Postal code |
11724 |
| Country |
USA |
| |
|
| Platform ID |
GPL15463 |
| Series (1) |
| GSE66986 |
Novel DICER-LIKE1 siRNAs Bypass the Requirement for DICER-LIKE4 in Maize Development |
|
| Relations |
| BioSample |
SAMN03421112 |
| SRA |
SRX957840 |
