 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Aug 13, 2015 |
| Title |
cde-1_hrde-1_IP |
| Sample type |
SRA |
| |
|
| Source name |
adult worms
|
| Organism |
Caenorhabditis elegans |
| Characteristics |
strain background: RFK90
genoptype/variation: cde-1(tm1021) III
developmental stage: adult worms
rip antibody: HRDE-1 antibody
rip antibody ref.: PMID:22738725
|
| Treatment protocol |
C. elegans L1 larvae were obtained by bleaching gravid adults and letting the eggs hatch in M9 over-night. L1 cross-offspring larvae were obtained single picking 200 eggs to an unseeded NGM plate, bleaching those eggs to remove any bacteria that was carried along, and allowed to hatch over-night. L1 larvae were then re-suspended in M9. To identify cross offspring, males were carrying the punc-119::GFP transgene. L2 larvae were single picked and washed in M9 buffer for each sample. Cross offspring was identified by the presence of a marker carried only by the male.
|
| Growth protocol |
worms were grown in NGM plates seeded with OP50
|
| Extracted molecule |
total RNA |
| Extraction protocol |
150 L1 or 50 L2 C. elegans larvae were washed in M9 buffer (22nM Na2HPO4, 33 mM KH2PO4, 86 mM NaCl, 1 mM MgSO4) and digested in lysis buffer (200mM NaCl, 100 mM Tris pH 8.5, 50 mM EDTA, 0.5 % SDS, 200 µg/mL Prot-K) for 3h at 65°C followed by 15 min at 95° C to denaturate the Prot-K. Lysate was then incubated with DNase I (NEB) for 30 min at 37° C. Total RNA was then isolated using TRIZOL-LS (Life Technologies) using the manufacturer instructions and dissolved in 8 µL of H2O.
For RIP-seq, HRDE-1 was precipitated from synchronized adult worms. 50 µL of packed worms were washed with M9 and sonicated in 200 µL of lysis buffer (25 mM Tris pH7.5, 150 mM NaCl, 1.5 mM MgCl, 1 mM DTT and cOmplete mini, EDTA free (Roche, 1 tablet per 100 mL) 5 times 30 sec ON, 30 sec OFF at the maximum energy setting. Lysates were centrifuged at 21000G for 5 min. 50 µL of the supernatant was used as input and 100 µL was incubated with 1 mg of anti-HRDE-1 antibody (Ashe et al. 2012) and 10 µL of Dynabeads Protein G (Life Technologies) for 2 hours. The beads were washed 5 times 10 min with wash buffer (25 mM Tris pH7.5, 150 mM NaCl, 1.5 mM MgCl, 1 mM DTT and cOmplete mini, EDTA free (Roche, 1 tablet per 100 mL, 0.2 % Triton X-100). RNA was extracted from both input and IP with TRIZOL-LS (Life Technologies) using the manufacturer instructions and dissolved in 8µL of H2O.
All 8uL of total RNA was treated with 5 U of tobacco acid phosphatase (Epicenter) at 37°C for 2 h to digest 5’ tri- and di-phosphates to mono-phosphates. RNA was size-selected between 15- to 35-nt on 15% TBE-urea gel. Gel-purified RNA was eluted overnight in 300 mM NaCl and then precipitated with 100% isopropanol and Glycoblue for 1 h at -20°C. The pellet was washed once with 75% ethanol and dissolved in nuclease-free water. Then, this purified fraction was confirmed by Bioanalyzer Small RNA chip (Agilent). Library preparation was based on the NEBNext Multiplex Small RNA Library Prep Set for Illumina (New England BioLabs) with slight modification. In brief, small RNA was first ligated to the 3’ adapter and then the 5’ adapter, both of which contained 4 random bases and were chemically synthesized by Bioo Scientific. Adapter-ligated RNA was reverse-transcribed and PCR-amplified for 14 cycles using index primers. The PCR-amplified cDNA construct was purified using AMPure XP beads (Beckman Coulter). The purified PCR reaction was checked on the Bioanalyzer using High Sensitivity DNA chip (Agilent). Size selection of the small RNA library was done on LabChip XT instrument (Perkin Elmer) using DNA 300 assay kit. Only the fraction containing 140-165 bp was pooled in equal molar ratio. The resulting 10 nM pool was denatured and diluted to 10 pM with 5% PhiX spike-in and sequenced as single-read on HiSeq 2500 (Illumina) in rapid mode for 50 cycles using on-board cluster generation. Sample “L1 N2” was sequenced as single-read on Miseq (Illumina). After demultiplexing, on average 35 million passing filter reads were obtained per sample.
|
| |
|
| Library strategy |
RIP-Seq |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina MiSeq |
| |
|
| Data processing |
The raw reads in FastQ format were filtered from 3’ adapter sequences and size-selected in the range 15-35 bases (plus 8 bases random barcodes) using cutadapt v.1.2.1 1using parameters: -a AGATCGGAAGAGCACACGTCT -O 8 -m 23 -M 43 . Subsequently, PCR clonal reads were deduplicated using Bash and Awk commands. All reads containing low-quality (Phred+33 score less than 20) bases were filtered with the FastX toolkit (http://hannonlab.cshl.edu/fastx_toolkit/; fastq_quality_filter -q 20 -p 100 -Q 33), then the files were reformatted from FastQ into tabular format, sorted and deduplicated based on full sequence identity (library insert plus 5’ and 3’ random barcodes of 4 nucleotides), and finally converted back to FastQ format for mapping. Quality assessment of the raw and processed data was done with FastQC (http://www.bioinformatics.babraham.ac.uk/projects/fastqc). Mapping to the C. elegans genome reference WS244 was performed using Bowtie v1 2 with parameters: -v0 -M1 --best --strata --nomaqround --tryhard --trimm5 4 --trim3 4. Unmapped reads where then filtered for the ones ending with a “T” using custom python scripts and remapped using bowtie using the same parameter but trimming one extra 3’ base. These newly mapped reads were considered mono-uridylated. This filtering/mapping cycle was performed 10 times in order to map up to penta-urydilated reads. All mapped reads where then annotated using bedtools intersect 3 with a customized WS244.gff3 (ftp://ftp.wormbase.org/pub/wormbase/releases/WS244/species/c_elegans/PRJNA13758/c_elegans/PRJNA13758.WS244.annotations.gff3.gz); using the following parameters: -abam -b[custom annotated gff3] -bed -wa -wb. Mapped and annotated reads were subsequently filtered for size and starting nucleotide using custom made python scripts and normalized to total of non-structural reads between 18 and 30 nucleotides. Structural reads were considered as reads that mapped rRNAs, tRNAs and snoRNAs. During the analysis we considered miRNA reads that were 22 to 24 nt long sense to annotated miRNAs, we considered piRNA reads that were 21 nt long, started with a “T” and were sense to annotated piRNAs, and 22G reads that were 20 to 23 nt long, started with a “G” and map antisense to genes, transposable elements or pseudogenes. In order to categorize genes, we retrieved WAGO-1 targets, ERGO-1 targets, mutator targets, ALG-3/4 targets and CSR-1 targets from Gu (2009),Vasale (2010), Phillips(2014), Conine (2010), Claycomb (2009)4–8 respectively. For each protein coding gene saw if it was a WAGO-1 target, if not we saw if it was an ERGO-1 target, if not we saw if it was a mutator target and so on, in the previously mention order. The validation of a gene in a category would automatically exclude it from the following categories; this was to insure that there would be no duplication, since some categories overlap partially.
Genome_build: WS240
Supplementary_files_format_and_content: read counts for: total mapped reads, mapped reads 18-30 nt, non structrural reads (18-30 nt), 18-30nt mapping genes_anti-sense, 18-30nt mapping genes_sense, 18-30 nt mapping pseudogenic_transcript_anti-sense, 18-30 nt mapping pseudogenic_transcript_sense, 18-30nt mapping to piRNAs_anti-sense, 18-30nt mapping to piRNAs_sense, 18-30nt mapping to transposable_elements_anti-sense, 18-30nt mapping to transposable_elements_sense, 18-30nt mapping to ncRNA_anti-sense, 18-30nt mapping to ncRNA_sense, 18-30nt mapping to snoRNA_anti-sense, 18-30nt mapping to snoRNA_sense, 18-30nt mapping to tRNA_anti-sense, 18-30nt mapping to tRNA_sense, 18-30nt mapping to antisense_RNA_anti-sense, 18-30nt mapping to antisense_RNA_sense, 18-30nt mapping to lincRNA_anti-sense, 18-30nt mapping to lincRNA_sense, 18-30nt mapping to miRNA_anti-sense, 18-30nt mapping to miRNA_sense, 18-30nt mapping to snRNA_anti-sense, 18-30nt mapping to snRNA_sense, 18-30nt mapping to rRNA_anti-sense, 18-30nt mapping to rRNA_sense, 18-30nt mapping to scRNA_anti-sense, 18-30nt mapping to scRNA_sense, piRNAs (20U-21U sense to annotated piRNAs), miRNA (20-24 nt mapping sense to annotated miRNAs), 20G-23G antisense to annotated transposons, 20G-23G antisense to annotated protein coding genes, 20G-23G antisense to ALG-3/4 targets, 20G-23G antisense to CSR-1 targets, 20G-23G antisense to ERGO-1 targets, 20G-23G antisense to WAGO-1 targets, 20G-23G antisense to mutator targets, 20G-23G antisense to other protein coding genes
|
| |
|
| Submission date |
May 18, 2015 |
| Last update date |
May 15, 2019 |
| Contact name |
Rene Ketting |
| E-mail(s) |
r.ketting@imb.de
|
| Organization name |
IMB
|
| Street address |
Ackermannweg 4
|
| City |
Mainz |
| ZIP/Postal code |
55128 |
| Country |
Germany |
| |
|
| Platform ID |
GPL15716 |
| Series (1) |
| GSE68988 |
Maternal piRNAs are essential for germline development following de-novo establishment of endo-siRNAs in Caenorhabditis elegans |
|
| Relations |
| BioSample |
SAMN03700716 |
| SRA |
SRX1032457 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM1689765_cde-1_IP.txt.gz |
512 b |
(ftp)(http) |
TXT |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
