 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Jul 17, 2017 |
| Title |
Footprint_let-7(n2853)_32hr |
| Sample type |
SRA |
| |
|
| Source name |
Whole-worm
|
| Organism |
Caenorhabditis elegans |
| Characteristics |
time in development: 32 hours
strain: let-7(n2853)
|
| Treatment protocol |
Worms were washed off the plates and subsequently washed three additional times with M9 buffer before lysis (Aeschimann et al., Methods, 2015)
|
| Growth protocol |
Arrested L1 stage larvae were obtained by extracting embryos from gravid adults with bleaching solution (30% (v/v) sodium hypochlorite (5% chlorine) reagent, 750 mM KOH) and hatching overnight in the absence of food, at room temperature in M9 buffer (42 mM Na2HPO4, 22 mM KH2PO4, 86 mM NaCl, 1 mM MgSO4). Synchronized arrested L1 larvae were then plated on enriched peptone plates with Escherichia coli NA22 bacteria and harvested after incubation at 25 °C for the desired time (referred to as hours of development).
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Worms were lysed and monosomes purified according to our detailed published protocol (Aeschimann et al., Methods, 2015). Monosomes were purified using linear sucrose density gradients for the first time course experiment (let-7(n2853) animals) and using size-exclusion chromatography for the second time course experiment (N2, lin-41(xe11) and lin-41(xe11); let-7(n2853) animals).
Performed as described in our detailed published protocol (Aeschimann et al., Methods, 2015).
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina HiSeq 2000 |
| |
|
| Data processing |
The 3' adaptor (TGGAATTCTCGGGTGCCAAGG) was removed from the reads using the function preprocessReads from within the bioconductor package QuasR (default parameters). The short fragments (about 30bp length) were mapped to the C. elegans genome (ce6) with the R package QuasR (www.bioconductor.org/packages/2.12/bioc/html/QuasR.html) using the included aligner bowtie allowing only for uniquely mapping reads. The command used to perform the alignments was "proj <- qAlign("samples.txt","BSgenome.Celegans.UCSC.ce6")". Gene expression (ce_geneExpression_riboM_rawCounts.txt) was quantified by counting the number of reads that started within any of the exons beloning to a particular gene (WormBase, WS190). The command used to create the count table was qCount(proj,exons,orientation="same"). To compensate for differences in the read depths of the various libraries, we divided each sample by the total number of reads and multiplied by the average library size. Log2 expression levels (ce_geneExpression_riboM_normalized.txt) were calculated after adding a pseudocount of 8 (y=log2(x+8)). This was done to minimize the large differences in expression that would otherwise be caused by genes with small number of counts. The N2 time-course experiment corresponding to let-7(n2853)_18hr-36hr is not part of this series as it was previously published (GSM1277907-GSM1277916).
|
| |
|
| Submission date |
Apr 11, 2016 |
| Last update date |
May 15, 2019 |
| Contact name |
Dimos Gaidatzis |
| E-mail(s) |
d.gaidatzis@fmi.ch
|
| Organization name |
Friedrich Miescher Institute
|
| Street address |
Maulbeerstrasse 66
|
| City |
Basel |
| ZIP/Postal code |
4058 |
| Country |
Switzerland |
| |
|
| Platform ID |
GPL13657 |
| Series (2) |
| GSE80133 |
Post-transcriptional regulation by the let-7 microRNA and the TRIM-NHL protein LIN41 [Ribosome footprinting] |
| GSE80159 |
Post-transcriptional regulation by the let-7 microRNA and the TRIM-NHL protein LIN41 |
|
| Relations |
| BioSample |
SAMN04632571 |
| SRA |
SRX1690278 |
| Supplementary data files not provided |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data are available on Series record |
|
|
|
|
 |
