GEO Accession viewer

NCBI > GEO > Accession Display

Not logged in | Login

GEO help: Mouse over screen elements for information.

Sample GSM2146885

Query DataSets for GSM2146885

Status

Public on Apr 11, 2017

Title

Promoter 1 Biological rep 1 Expression

Sample type

SRA

Source name

I_rep1_rna.fastq.gz

Organism

Drosophila melanogaster

Characteristics

cell line: Kc167

Growth protocol

Kc167 cells were maintained in Schneider’s Drosophila medium (Gibco). Transfections were performed by electroporating 20 million cells with 20 ug of plasmid DNA and 10 ug barcoded pT2-promoter-GFP (plasmid libraries at 1 ug/ul with a complexity higher than 10E6), 5 ug pC-sleeping beauty (Addgene plasmid #65487) and 5 ug LNGFR expression plasmid at 250 V and 1000 uF. The cells were counted, pelleted at 300 g for 5 minutes, resuspended and electroporated in 750 uL of medium in Biorad cuvettes (0.4 cm) in a GenePulser II Electroporation system (Biorad). Immediately after electroporation 700 ul of the electroporated cell suspension were transferred to 25 cm2 flasks containing 5 mL of fresh medium, leaving the top layer of dead cells that forms in the cuvette. 24 hours after electroporation the expression of the Sleeping Beauty 100X transposase and of LNGFR were induced by two heat shocks at 37 °C of two hours each, with at least four hours recovery between them. The next day, two more heat shocks were given in the same conditions. At day three after electroporation, LNGFR positive cells were selected using MACSelect LNGFR micro beads (Miltenyi biotech) and pools of 10.000, 20.000 or 50.000 cells were plated in 25 cm2 flasks containing 5 mL and grown for 2 weeks transferring to a 75 cm2 when the culture reached a density of 10 million cells/mL.

Extracted molecule

total RNA

Extraction protocol

Reporter expression: RNA was extracted using Trizol (Life Technologies). 100 ug of total RNA were taken for polyA+ selection (Oligotex mRNA mini Kit Qiagen). Reverse transcription (ThermoScript, Life Technologies) was performed on 2 ug mRNA using a primer (ACACTCTTTCCCTACACGACGCTCTTCCGATCT) specific of the barcoded reporter transcripts. In order to add the Illumina adaptors and indexes needed for single-end sequencing, 2 ul of cDNA or 500 ug of genomic DNA (normalization control) were amplified by PCR (98 °C for 1 min // 98 °C for 15 sec / 68 °C for 30 sec / 72 °C for 1 min // – 25 cycles / 72 °C for 3 min) with primers AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT and CAAGCAGAAGACGGCATACGAGAT [index] GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTGC. Approximately 5000 molecules of the oligonucleotide GCACGCCTTCAAGACCCCCATCGCCTTCGCCAGATCTCGAGCTTAGGGATAACAGGGTAATCATGNNNNNNNNNNNNNNNNNNNNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT were added to the template mixture of the PCR above. This oligonucleotide is a target for the primer pair above, and it contains a barcode of 20 nucleotides making every molecule unique. This allows to infer the read count corresponding to a single molecule of template.
High-Seq Single-end sequencing 1 * 50bp

Library strategy

RNA-Seq

Library source

transcriptomic

Library selection

cDNA

Instrument model

Illumina HiSeq 2000

Description

Promoter 1

Data processing

Mapping. Reads from the inverse PCR were trimmed in order to isolate the barcode and the sequence at the insertion point. In the forward read, barcodes were identified as the nucleotides preceding the NlaIII site (CATG), and in the reverse read, the Drosophila sequence flanking the transposon was identified as the nucleotides following the plasmid sequence TGTATGTAAACTTCCGACTTCAACTGTA (allowing up to 5 errors). After trimming, reverse reads were mapped to the genome of Drosophila melanogaster (dm3/Release5) with GEM version 1.376 (beta) with options -m3 --unique-mapping, giving a candidate insertion point for the associated barcode on the forward read. Barcode sequences were clustered using Starcode (Bioinformatics 2015 31:1913-9. doi: 10.1093/bioinformatics/btv053) with default parameters and each sequence was replaced by the centroid of the cluster. Since the same barcodes may be associated to different insertion points, we used a voting scheme to associate barcodes to a unique location. We kept locations representing over 10% of the read counts for a given barcode. If all those locations were within a 10 bp genomic window, the most frequent location was attributed as the unique location of the barcode. Otherwise, the barcode was discarded for being duplicated or unmapped. Reporter expression. Reads from the RT-PCR and genomic PCR, barcodes were identified with the NlaIII site and clustered with Starcode as above. Barcodes were then matched with their location (or discarded if unmatched). Spikes were identified as reads containing the sequence CATGATTACCCTGTTATC (allowing up to 2 errors) and the corresponding barcodes were extracted and clustered as above. The mean number of read counts per spike was computed and half of this value was added to the read count of each barcode (i.e. we added a pseudo count corresponding to half a molecule). Corrected values were normalized to the total read count of the experiment and summed over replicates. The normalized expression of a reporter was defined as the log2 ratio of the RT-PCR score and genomic PCR score computed above.
Genome_build: dm3/Release5
Supplementary_files_format_and_content: text file with barcode, chr, strand, position, normalized expression, promoter, rep

Submission date

May 09, 2016

Last update date

May 15, 2019

Contact name

Guillaume J Filion

E-mail(s)

guillaume.filion@gmail.com

Phone

+33783006131

Organization name

UTSC