|
| Status |
Public on Feb 15, 2017 |
| Title |
SNU175_rs1800734_genomic |
| Sample type |
SRA |
| |
|
| Source name |
Colorectal cancer cell line
|
| Organism |
Homo sapiens |
| Characteristics |
cell line: SNU175
cell type: Colorectal cancer cell line
genetic modification: none
library strategy: targeted DNA-seq
|
| Treatment protocol |
COLO320 isogenic lines (G/G, A/A) were generated by CRISPR-CAS9 site specific mutation. COLO320 (G/A) was mocked with the empty vector.
|
| Growth protocol |
RPMI medium supplemented with 10% fetal bovine, 100 U/ml penicillin and 100 µg/ml streptomycin.
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
Libraries were purified using QIA quick column (DNase I-seq, ATAC-seq, Targeted RNA-/DNA-seq, and 4C-seq), QIA minElute column (ChIP-seq) or SPRI beads (ATAC-seq).
Libraries were prepared according to Illumina's instructions.
|
| |
|
| Library strategy |
OTHER |
| Library source |
genomic |
| Library selection |
other |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Description |
Amplicon containing rs1800734; FW primer: TGGATGGCGTAAGCTACA, REV primer: CAGTTCTCAATCATCTCTTTG
|
| Data processing |
Illumina Casava software 1.8.2 used for basecalling of Hiseq2000 and NextSeq 500 data.
Library strategy (H3K27ac ChIP-seq): mapping: bwa-aln (0.7.10-r789), peak calling: macs2 (version 2.0.10.20130306) q=0.01 --broad option
Library strategy (ChIP-seq/Dnase I-seq/Target RNA or DNA-seq): mapping: bwa-aln (0.7.10-r789), peak calling: macs2 (version 2.0.10.20130306) q=0.01; Allele-specific read counts: IGV (version 2.3)
Library strategy (ATAC-seq): mapping: bwa-mem (0.7.10-r789), peak calling: macs2 (version 2.0.10.20130306) q=0.01; Allele-specific read counts: IGV (version 2.3)
Library strategy (4C-seq): mapping: bwa-aln (0.7.10-r789), data analysis: R package 'r3Cseq' (version 3.3)
Genome_build: hg19
Supplementary_files_format_and_content: bigWig files were generated using "bam2bw" script (https://bitbucket.org/simonvh/bam2bw/src), bedGraph files were generated using R package "r3Cseq".
|
| |
|
| Submission date |
Jul 01, 2016 |
| Last update date |
Nov 11, 2022 |
| Contact name |
Ning Qing Liu |
| E-mail(s) |
n.liu@erasmusmc.nl
|
| Organization name |
Erasmus University Medical Center Rotterdam
|
| Department |
Hematology
|
| Street address |
Wytemaweg 80
|
| City |
Rotterdam |
| ZIP/Postal code |
3015 CN |
| Country |
Netherlands |
| |
|
| Platform ID |
GPL18573 |
| Series (1) |
| GSE83968 |
The non-coding variant rs1800734 enhances DCLK3 expression through long-range interaction and promotes colorectal cancer progression |
|
| Relations |
| BioSample |
SAMN05346329 |
| SRA |
SRX1892864 |
