|
| Status |
Public on Jan 04, 2017 |
| Title |
S2P mNET-Seq untreated rep2 |
| Sample type |
SRA |
| |
|
| Source name |
S2P mNET-Seq untreated
|
| Organism |
Homo sapiens |
| Characteristics |
cell line: HeLa
genotype/variation: Control: Empigen untreated Ser2 phospho
molecule subtype: Polymerase bound RNA
|
| Treatment protocol |
1% Empigen was aded IP buffer and IP washing buffer.
siRNAs were transfected for 60-72 hrs accroding to RNAiMAX reagent protocol.
|
| Growth protocol |
HeLa cells were maintained in DMEM with 10% fetal bovine serum.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Nascent RNAs were prufied from Pol II IP products of solubilized chromatin.
Libraries were prepared acooding to the protocols of Trueseq small RNA sequencing preparation kit (Illumina) for mNET-seq; Ultra directional RNA sequencing preparation kit (NEB) for chrRNA and Np RNA-seq.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina HiSeq 4000 |
| |
|
| Data processing |
library strategy: mNET-Seq
Adapter trimming with Cutadapt v. 1.8.3 in paired end mode with the following parameters: -A GATCGTCGGACTGTAGAACTCTGAAC -a TGGAATTCTCGGGTGCCAAGG --minimum-length 10
Alignment with Tophat v. 2.0.13 and the parameters -g 1 -r 3000 --no-coverage-search to hg19
Extraction of properly paired, properly mapped reads (samflags 0x63, 0x93, 0x53, 0xA3) with SAMtools v. 1.2
For mNET-Seq profiles only the most 3’ nucleotide of the second read was used with the strandedness of the first read
BigWig files were generated from the above bedgraph files through the bedGraphToBigWig tool (Kent et al., 2002).
Data was visualized with Bedtools v. 2.23.0 (genomeCoverageBed).
Genome_build: hg19
Supplementary_files_format_and_content: bigwig files: genome-coverage files for all samples
|
| |
|
| Submission date |
Oct 20, 2016 |
| Last update date |
May 15, 2019 |
| Contact name |
Monika Gullerova |
| E-mail(s) |
monika.gullerova@path.ox.ac.uk
|
| Phone |
+44794220892
|
| Organization name |
University of Oxford
|
| Department |
Sir William Dunn School of Pathology
|
| Street address |
South Parks Road
|
| City |
Oxford |
| ZIP/Postal code |
OX1 3RE |
| Country |
United Kingdom |
| |
|
| Platform ID |
GPL20301 |
| Series (1) |
| GSE81662 |
Nuclear Surveillance of long intervening noncoding RNA |
|
| Relations |
| BioSample |
SAMN05932828 |
| SRA |
SRX2255597 |
