|
|
GEO help: Mouse over screen elements for information. |
|
Status |
Public on Aug 31, 2017 |
Title |
E12.5_PGC_Male ChIP-Seq, input |
Sample type |
SRA |
|
|
Source name |
E12.5_PGCM, input
|
Organism |
Mus musculus |
Characteristics |
strain: C57BL/6 chip antibdy: Input genotype: Homozygous EGFP-knocked-in at the N terminus of BLIMP1 (EGFP-BLIMP1) cell sorting: FACS (SSEA1+)
|
Extracted molecule |
genomic DNA |
Extraction protocol |
EGFP-BLIMP1 embryos were obtained with intracytoplasmic sperm injection (ICSI) to oocytes (Kimura, 1995 #3053) and transfer of two-cell-stage embryos into oviducts of the surrogate mother mice. The embryonic male gonads at E12.5 were collected, for which sex was determined with the morphological features, and dissociated into single cells by incubating with 0.05 % trypsin and 0.5 mM EDTA (GIBCO) in PBS at 37 °C for 5 min. The cell suspension was then incubated with mouse anti-SSEA1 antibody conjugated with Alexa Fluor 647 (BioLegend). SSEA1 positive cells were purified with FACS. Chromatin immunoprecipitation was performed as described previously(Kurimoto et al., 2015). Libraries for ChIP_seq were prepared as described (Kurimoto, 2015 Cell Stem Cell) with a modification for application to the Illumina systems. Briefly, ChIP-ed and input DNAs were sheared to an average size of 150 bp by ultra-sonication (Covaris S2). The sheared DNAs were end-repaired, dA-tailed, ligated to an amplification adaptor (P1-T Adaptor/F and Barcode-Internal+12-mer/R), amplified with a 10-cycle PCR using Library PCR primer 1 (Life technologies) and Library PCR primer Barcode001 + Internal adaptor. For sequencing on the Illumina systems, we then added an adaptor and index to the amplified library with two rounds of additional PCRs. The 1st round additional PCR was performed for 6 cycles with Read1-P1 and Read2-internal-adaptor primers. The 2nd round PCR was performed for 4 cycles with Illumina P5-Read1 primer and P7-index N-Read2 primer to produce the index-tagged library DNAs. To exclude the initial constant region consisted of the amplification adaptor sequence (P1-T Adaptor) and maximize the efficient sequencing reads, we designed a custom sequencing primer, Custom-primer-29mer (Supplementary Table S2 of the manuscript), which met sequencing on Illumina platform (Caporaso, 2011 PNAS) in terms of the length, GC content, and melting temperature. The DNAs were then sequenced on the HiSeq 2500 platform (Illumina) in high throughput mode to generate single-end 100-bp reads, as the manufacturer's instruction.
|
|
|
Library strategy |
ChIP-Seq |
Library source |
genomic |
Library selection |
ChIP |
Instrument model |
Illumina HiSeq 2500 |
|
|
Description |
genomic DNA, Input
|
Data processing |
All reads were processed with the trim_galore program (Trim Galore! version 0.3.7 and cutadapt 1.7.1) using the "-a ATCACCGACTGCCACGCCTTGGCCGTACAGCA GCCT" and "-q 20" options to remove the SOLiD adaptor (P1-T adaptor) sequence and low quality reads, respectively. The processed reads with 20 bases and longer were mapped on the mouse genome mm10 by Bowtie v1.1.2 with the "-n 3", "-best" and "-M 1" options. Tdf files are made using igvtools v2.3.52 with "-w 25 -e 250" options. BLIMP1 enrichment peaks was detected by MACS2_v2.1 with default parameter. Genome_build: mm10
|
|
|
Submission date |
Dec 08, 2016 |
Last update date |
May 15, 2019 |
Contact name |
Yukihiro Yabuta |
E-mail(s) |
yabyab@anat2.med.kyoto-u.ac.jp
|
Organization name |
Kyoto University, Graduate school of medicine
|
Department |
Anatomy and Cell Biology
|
Street address |
Yoshida-Konoe-cho, Sakyo-ku
|
City |
Kyoto |
State/province |
Kyoto |
ZIP/Postal code |
606-8501 |
Country |
Japan |
|
|
Platform ID |
GPL17021 |
Series (2) |
GSE91038 |
Principles for the regulation of multiple developmental pathways by a versatile transcriptional factor, BLIMP1(ChIP-Seq) |
GSE91041 |
Principles for the regulation of multiple developmental pathways by a versatile transcriptional factor, BLIMP1 |
|
Relations |
BioSample |
SAMN06122621 |
SRA |
SRX2404799 |
Supplementary file |
Size |
Download |
File type/resource |
GSM2420064_E125PGCinput.tdf.gz |
273.7 Mb |
(ftp)(http) |
TDF |
SRA Run Selector |
Raw data are available in SRA |
Processed data provided as supplementary file |
|
|
|
|
|