 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Jun 08, 2017 |
| Title |
NSR_Brain |
| Sample type |
SRA |
| |
|
| Source name |
Brain
|
| Organism |
Anolis carolinensis |
| Characteristics |
sequencing type: NSR-Seq
|
| Growth protocol |
RNA was isolated directly from adult brain or testis of Anolis carolinensis.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Total RNA and small RNA was extracted from homogenized testis and/or brain tissue using TRIzol .
For NSR-Seq libraries: First strand cDNA synthesis was performed using SuperScript III and the “not-so-random” forward primer set (5’ TCCGATCTCTNNNNNNN 3’), followed by second strand synthesis using exo- Klenow fragment and the “not-so-random” reverse primer set (5’ TCCGATCTGANNNNNNN 3’). In order to deplete ribosomal RNAs from the libraries, “not-so-random” primer sets were designed by pooling 749 unique hexamers with no perfect match to human cytoplasmic 18S and 28S rRNA and mitochondrial 12S and 16S rRNA transcripts. Libraries were subsequently amplified by PCR using primers (5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTCT 3’ and 5’ CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCTGA 3’) and paired-end sequenced for 50x2 cycles on Illumina Genome Analyzer II according to manufacturers’ instructions. For small RNA libraries: RNA was ligated to 3′ and 5′ adaptors, gel purified after each ligation, reverse transcribed, and PCR amplified using Solexa sequencing primers. PCR product was gel purified, quantified, and sequenced for 36 cycles or 76 cycles on Illumina Genome Analyzer II according to manufacturers’ instructions.
"Not-So-Random" RNA-Seq, small RNA-Seq
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina Genome Analyzer II |
| |
|
| Data processing |
Illumina Casava software used for basecalling.
The quality of the raw data was evaluated using FastQC.
NSR-Seq: reads were mapped using STAR and sorted using samtools.
Small RNA-Seq: reads were trimmed from 3′ linker and filtered for low-quality reads. Unique sequences 24 nt or longer in length were mapped using Bowtie.
Genome_build: anoCar2.0
Supplementary_files_format_and_content: bedgraph
|
| |
|
| Submission date |
Apr 05, 2017 |
| Last update date |
May 15, 2019 |
| Contact name |
Sarah D Diermeier |
| E-mail(s) |
sarah.diermeier@otago.ac.nz
|
| Organization name |
University of Otago
|
| Department |
Biochemistry
|
| Lab |
Diermeier
|
| Street address |
710 Cumberland Street
|
| City |
Dunedin |
| ZIP/Postal code |
9016 |
| Country |
New Zealand |
| |
|
| Platform ID |
GPL23260 |
| Series (1) |
| GSE97451 |
Identification and Characterization of a Class of MALAT1-like Genomic Loci |
|
| Relations |
| BioSample |
SAMN06689582 |
| SRA |
SRX2711638 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM2564798_testis_all_smooth.ucsc.bedGraph.gz |
86.4 Mb |
(ftp)(http) |
BEDGRAPH |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
