|
| Status |
Public on Sep 11, 2018 |
| Title |
PGC-1α-KD C2C12 + FLAG-PGC-1α(WT) 1 |
| Sample type |
SRA |
| |
|
| Source name |
stable PGC-1α-KD C2C12 myoblasts
|
| Organism |
Mus musculus |
| Characteristics |
transfection: plasmid encoding FLAG-tagged WT PGC-1α
|
| Treatment protocol |
To generate C2C12 MBs in which PGC-1α was stably knocked-down, HEK293T cells were transiently transfected with VSV-G plasmid (Addgene, 8454) and pCG-gag-pol (Ulm et al., 2007) and, respectively, MISSION shRNA pLKO.1-puro vector for PGC-1α (TRCN0000234017: CCGGTCCAGTAAGCACACGTTTATTCTCGAGAATAAACGTGTGCTTACTGGATTTTTG; Sigma) or pRetroSuper-GFP-shRNA (Brummelkamp et al., 2000). C2C12 MBs were transduced using the resulting viral supernatants (MOI of 1) supplemented with 2 µg/ml of hexadimethrine bromide (Sigma). After 24 hr, cells were selected for resistance to 2 mg/ml of puromycin (Gibco), and resistant cells were pooled. WT or PGC-1α-KD myoblasts were transiently transfected with the indicated plasmids using Lipofectamine 2000 (Life Technologies) and harvested 32-hr later.
|
| Growth protocol |
Mouse C2C12 myoblasts were cultured in Dulbecco´s Modified Eagle´s Medium (DMEM; Gibco) containing 15% fetal bovine serum (Gibco) and 1% penicillin/streptomycin (Gibco).
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Total RNA was extracted using Trizol (Ambion).
The TruSeq Stranded mRNA Sample Preparation Kit (Illumina, San Diego, CA) was used for next-generation sequencing library construction following the manufacturer’s protocols. Briefly, poly(A)+ RNA was purified from 200 ng of total C2C12-cell RNA using oligo-dT magnetic beads and fragmented. First-strand cDNA synthesis was performed using random hexamer priming followed by second-strand cDNA synthesis using dUTP incorporation for strand marking. The resulting double-stranded cDNA was then subjected to end repair and 3´-end adenylation. Illumina adaptors were ligated to both cDNA ends. Adapted cDNA was purified using Ampure beads and PCR-amplified using primers specific to the adaptor sequences to generate cDNA amplicons of approximately 200-500 base-pairs. Amplified libraries were hybridized to the Illumina single-end flow cell and further amplified using the cBot (Illumina, San Diego, CA). Single-end reads of 100 nucleotides were generated for each sample using HiSeq2500v4 (Illumina).
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina HiSeq 2500 |
| |
|
| Data processing |
DEMULTIPLEXING - bcltofastq-1.8.4
CLEANING - Trimmomatic-0.36 "TRAILING:13 LEADING:13 ILLUMINACLIP:adapters.fasta:2:30:10 SLIDINGWINDOW:4:20 MINLEN:15"
MAPPING - STAR_2.5.2b "--twopassMode Basic --runMode alignReads --genomeDir ${GENOME} --readFilesIn ${SAMPLE} --outSAMtype BAM SortedByCoordinate --outSAMstrandField intronMotif --outFilterIntronMotifs RemoveNoncanonical"
READ COUNTING - subread-1.5.0p3, featurecounts, "-s 2 -t exon -g gene_name"
Genome_build: GRCm38.p5 + Gencode-M12 Annotation
Supplementary_files_format_and_content: text file includes raw expression counts
|
| |
|
| Submission date |
Sep 06, 2017 |
| Last update date |
May 15, 2019 |
| Contact name |
Lynne Maquat |
| E-mail(s) |
Lynne_Maquat@URMC.Rochester.edu
|
| Organization name |
University of Rochester
|
| Department |
Biochemistry and Biophysics
|
| Lab |
MC 3-8507C
|
| Street address |
601 Elmwood Ave
|
| City |
Rochester |
| State/province |
New York |
| ZIP/Postal code |
14642 |
| Country |
USA |
| |
|
| Platform ID |
GPL17021 |
| Series (1) |
| GSE103566 |
Transcriptional coactivator PGC-1α contains a novel CBP80-binding motif that orchestrates efficient target gene expression |
|
| Relations |
| BioSample |
SAMN07611336 |
| SRA |
SRX3165249 |
