|
| Status |
Public on Mar 28, 2018 |
| Title |
p_150909_CXT1 |
| Sample type |
SRA |
| |
|
| Source name |
cortex from PND13 mice
|
| Organism |
Mus musculus |
| Characteristics |
tissue: cortex
|
| Treatment protocol |
tissue grinded in liquid nitrogen and crosslinked 3 x 400mJ, 254nm
|
| Extracted molecule |
total RNA |
| Extraction protocol |
FMRP-IP, proteinase K, phenol:chloroform extraction
CleanTag Ligation Kit for Small RNA Library Prep (trilink)
|
| |
|
| Library strategy |
RIP-Seq |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Ion Torrent Proton |
| |
|
| Description |
fragments_count_table.txt
|
| Data processing |
Reads adaptor trimming with cutapdapt (v1.2.1). Proton 5’ adapter sequence (--front = TTCTACAGTCCGACGATC). Proton 3’ adapter sequence (--adapter = TGGAATTCTCGGGTGCCAAGG) and SOLiD 3' adapter sequence(--adapter=33020103).
Trimmed reads with a length under 20 bases were discarded.
Remaining reads were aligned with bowtie (version 0.12.7) directly to refseq transcriptome downloaded from NCBI ftp server (release 20161019) with “--best --strata --norc”.
Reads mapped to more than one unique gene were discard with a custom java class based on Picard java API.
Alignment files were filtered to discards PCR duplicates by keeping only one read per alignment start position taking into account possible stretch of soft clipped bases at the 5’ of the reads.
Resulting reads are called fragments and represent the signal of our CLIP experiments aiming at the detection of the FMRP binding sites.
Genome_build: mm10
Supplementary_files_format_and_content: Fragments counts per sample and per gene.
|
| |
|
| Submission date |
Sep 26, 2017 |
| Last update date |
May 15, 2019 |
| Contact name |
Kevin Lebrigand |
| Organization name |
IPMC/CNRS
|
| Lab |
Functional Genomics Platform of Nice-Sophia-Antipolis, France.
|
| Street address |
660 route des lucioles
|
| City |
Valbonne - Sophia-Antipolis |
| ZIP/Postal code |
06560 |
| Country |
France |
| |
|
| Platform ID |
GPL18635 |
| Series (1) |
| GSE104269 |
Modulation of synaptic phosphodiesterase PDE2A activity is a new therapeutic approach for Fragile X Syndrome in newborns and adolescents. |
|
| Relations |
| BioSample |
SAMN07702820 |
| SRA |
SRX3217320 |
