|
| Status |
Public on Dec 04, 2018 |
| Title |
Aged_Daughter 3a5B |
| Sample type |
SRA |
| |
|
| Source name |
LT-HSC sorted from aged mouse (daughter cell)
|
| Organism |
Mus musculus |
| Characteristics |
strain: B6.SJL mice
tissue: Long-term Hematopoietic stem cells (LT-HSC)
|
| Growth protocol |
Cells were cultured in IMDM + 10% FBS + Cytokines mSCF,GCSF, and mTPO 50ng/ml at 37°C (5% CO2, 3% O2). Mother cells were collected 16hrs after culture. Daughter cells were cultured for 40 to 44 hrs, for first cell division.
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
cells were separated by pipetting and singularly subjected to fragmentation of open chromatin-regions using Tn5 transposase (Illumina), followed by a pre-amplification step, library preparation and subsequent paired-end sequencing.
For the pre-amplification step, NEBNext Ultra II Q5 Master Mix was used with Primer 1: 5’GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG3’ and Primer 2: 5’TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG3’. For dual-indexing, 10 μL of the pre-amplified ATAC reaction was used as input for Nextera index kit (Illumina). The generated libraries were quantified using agilent bio-analyzer and qPCR kit (New England Biolabs).
|
| |
|
| Library strategy |
ATAC-seq |
| Library source |
genomic |
| Library selection |
other |
| Instrument model |
Illumina HiSeq 3000 |
| |
|
| Data processing |
Standard Illumina software used for basecalling and demultiplexing
Adaptor trimming was performed using cutadapt 1.9.1
Sequences were aligned to the UCSC mouse reference genome mm10 using Bowtie 2
Peak calling was performed using MACS2
Genome_build: mm10
Supplementary_files_format_and_content: bed format
|
| |
|
| Submission date |
Jul 06, 2018 |
| Last update date |
Dec 04, 2018 |
| Contact name |
Medhanie Assmelash Mulaw |
| E-mail(s) |
medhanie.mulaw@uni-ulm.de
|
| Organization name |
University of Ulm
|
| Street address |
Albert-Einstein-Allee 11
|
| City |
Ulm |
| ZIP/Postal code |
89081 |
| Country |
Germany |
| |
|
| Platform ID |
GPL21493 |
| Series (2) |
| GSE116707 |
Aging alters the epigenetic asymmetry of HSC division [scATAC-Seq] |
| GSE116712 |
Aging alters the epigenetic asymmetry of HSC division |
|
| Relations |
| BioSample |
SAMN09622541 |
| SRA |
SRX4347397 |
