|
Status |
Public on Dec 04, 2018 |
Title |
Aged_Daughter 3a5B |
Sample type |
SRA |
|
|
Source name |
LT-HSC sorted from aged mouse (daughter cell)
|
Organism |
Mus musculus |
Characteristics |
strain: B6.SJL mice tissue: Long-term Hematopoietic stem cells (LT-HSC)
|
Growth protocol |
Cells were cultured in IMDM + 10% FBS + Cytokines mSCF,GCSF, and mTPO 50ng/ml at 37°C (5% CO2, 3% O2). Mother cells were collected 16hrs after culture. Daughter cells were cultured for 40 to 44 hrs, for first cell division.
|
Extracted molecule |
genomic DNA |
Extraction protocol |
cells were separated by pipetting and singularly subjected to fragmentation of open chromatin-regions using Tn5 transposase (Illumina), followed by a pre-amplification step, library preparation and subsequent paired-end sequencing. For the pre-amplification step, NEBNext Ultra II Q5 Master Mix was used with Primer 1: 5’GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG3’ and Primer 2: 5’TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG3’. For dual-indexing, 10 μL of the pre-amplified ATAC reaction was used as input for Nextera index kit (Illumina). The generated libraries were quantified using agilent bio-analyzer and qPCR kit (New England Biolabs).
|
|
|
Library strategy |
ATAC-seq |
Library source |
genomic |
Library selection |
other |
Instrument model |
Illumina HiSeq 3000 |
|
|
Data processing |
Standard Illumina software used for basecalling and demultiplexing Adaptor trimming was performed using cutadapt 1.9.1 Sequences were aligned to the UCSC mouse reference genome mm10 using Bowtie 2 Peak calling was performed using MACS2 Genome_build: mm10 Supplementary_files_format_and_content: bed format
|
|
|
Submission date |
Jul 06, 2018 |
Last update date |
Dec 04, 2018 |
Contact name |
Medhanie Assmelash Mulaw |
E-mail(s) |
medhanie.mulaw@uni-ulm.de
|
Organization name |
University of Ulm
|
Street address |
Albert-Einstein-Allee 11
|
City |
Ulm |
ZIP/Postal code |
89081 |
Country |
Germany |
|
|
Platform ID |
GPL21493 |
Series (2) |
GSE116707 |
Aging alters the epigenetic asymmetry of HSC division [scATAC-Seq] |
GSE116712 |
Aging alters the epigenetic asymmetry of HSC division |
|
Relations |
BioSample |
SAMN09622541 |
SRA |
SRX4347397 |