|
|
GEO help: Mouse over screen elements for information. |
|
Status |
Public on Oct 06, 2018 |
Title |
Replicate 2 sRNA library |
Sample type |
SRA |
|
|
Source name |
BW25113
|
Organism |
Escherichia coli |
Characteristics |
strain: BW25113 genotype: wild type
|
Growth protocol |
20 mL LB cultures, induced with arabinose (0.8% w/v final conc) and aTc (100 ng/mL final conc) for gI intron samples and arabinose only (0.8% w/v final conc) for sRNA samples in early exponential growth phase, sampled in exponential growth phase (OD~0.7)
|
Extracted molecule |
total RNA |
Extraction protocol |
RNA was harvested using Trizol reagent.NEBNext Multiplex Small RNA Library Prep set for Illumina (NEB E7330) was used with 0.5-1 ug of total RNA for the construction of sequencing libraries. RNA libraries were prepared for sequencing using standard Illumina protocols, with some exceptions: importantly, NO FRAGMENTATION was performed to preserve the ability to assign transcript length to each unique asRNA. Sequencing facility additionally performed a Pippin Prep (Sage Science) to select for transcript sizes between 120 and 310 nucleotides.
|
|
|
Library strategy |
RNA-Seq |
Library source |
transcriptomic |
Library selection |
cDNA |
Instrument model |
Illumina NextSeq 500 |
|
|
Data processing |
trimming adaptors with cutadapt (1.14) alignment to reference genome with bwa (0.7.16a) mem option (reference genome indexed using bwtsw option) for sRNA library data ONLY, excluding multimapped (XA) or chimeric (SA) tags using 'grep' converting .sam file to .bam and sorting by unique ID using samtools (1.1) view converting .bam files to .bed using bedtools (2.26.0) bamtobed filtering out R1 reads that do not contain at least 7 nucleotides (from the 5' end) of the asRNA sequence using 'grep' separating R1 and R2 reads within each sample using 'awk' sorting by unique ID and joining R1 and R2 files by unique ID using linux sort and join commands Genome_build: Genome for gI intron INTERFACE = groupI_O-INTERFACE_genome.fa. Genome for sRNA INTERFACE=sRNA_INTERFACE_genome.fa. Genomes are "built" to consist of one "gene" for each asRNA in the library; in order of: (i) upstream promoter sequence (variable), (ii)asRNA sequence, (iii)downstream assay components (RSE, linker, RBS, truncated GFP = 'TACCATTCACCTCTTGGATTTGGGTATTAAAGAGGAGAAAGGTACCATGAATATCTTACATATATGTGTGACCTCAAAATGGTTCAATATTGACAACAAAATTGTCGATCACCGCCCTTGATTTGCCCTTCTGTAGCCATCACCAATGAGTCAATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCCACACAATCTGCCCTTTCGAAAGATCCCAACGAAAAGAGAGACCACATGGTCCTTCTTGAGTTTGTAACAGCTGCTGGGATTACACATGGCATGGATGATCTCTACAAATAA') Supplementary_files_format_and_content: Processed data (.bed) files consist of lines corresponding to a unique read (column 1), the synthetic gene to which it maps (column 2 & 8), the starts and ends of each R1 (columns 3,4 for the sRNA library and columns 9,10 for the gI intron library, respectively) and R2 (columns 9,10 for the sRNA library and columns 3,4 for the gI intron library, respectively), as well as read quality.
|
|
|
Submission date |
Jul 31, 2018 |
Last update date |
Oct 06, 2018 |
Contact name |
Mia Mihailovic |
E-mail(s) |
mihailom@utexas.edu
|
Organization name |
UT Austin
|
Department |
McKetta Dept of Chem Eng
|
Lab |
Contreras Lab
|
Street address |
200 E Dean Keeton St
|
City |
Austin |
State/province |
Texas |
ZIP/Postal code |
78705 |
Country |
USA |
|
|
Platform ID |
GPL21222 |
Series (1) |
GSE117939 |
High throughput in vivo mapping of RNA accessible interfaces to identify functional sRNA binding sites |
|
Relations |
BioSample |
SAMN09745165 |
SRA |
SRX4492860 |
Supplementary file |
Size |
Download |
File type/resource |
GSM3315598_pairedreads10.bed.gz |
24.0 Mb |
(ftp)(http) |
BED |
SRA Run Selector |
Raw data are available in SRA |
Processed data provided as supplementary file |
|
|
|
|
|