|
|
GEO help: Mouse over screen elements for information. |
|
Status |
Public on Jul 01, 2020 |
Title |
PL_1 |
Sample type |
SRA |
|
|
Source name |
Mouse bone marrow
|
Organism |
Mus musculus |
Characteristics |
cell type: Bone marrow derived dendritic cells strain: C57BL/6 ligands: PAM, LPS
|
Treatment protocol |
2.5X10^6 BMDCs were plated in2.5 mL of medium in non-tissue culture treated 6cm plate and incubated overnight prior to ligand stimulations as indicated.
|
Growth protocol |
Bone marrow-derived dendritic cells (BMDCs) were generated from 6- to 8-week old female C57BL/6J mice. Bone marrow cells were collected from femora and tibiae and plated at 2X10^6 cells in 10-cm non-tissue culture treated petri dishes (Corning 351029) in 10 mL of complete RPMI medium containing RPMI-1640 medium (ThermoFisher Scientific 11875119) supplemented with 10% volume/volume (v/v) heat-inactivated fetal bovine serum (Seradigm 1400-500), L-glutamine (2 mM, Corning 25005CI), penicillin/streptomycin (100 U/mL/100g/mL, Lonza Biowhittaker 17602E), MEM non-essential amino acids (0.5X, Corning 25025CI), HEPES (10 mM, Corning 25-060-CI), sodium pyruvate (1 mM, Corning 25000CI), -mercaptoethanol (55M, Fisher Scientific 21-985-023), and recombinant murine GM-CSF (15 ng/mL; Peprotech 315-03-100g). Cells were fed at day 2, 5 and 7 with 3 mL of complete RPMI medium supplemented with GM-CSF as described.
|
Extracted molecule |
genomic DNA |
Extraction protocol |
To extract nuclei 50,000 mouse BMDCs were lysed in lysis buffer containing 10 mM Tris-HCl, pH 7.4, 10 mM NaCl, 3 mM MgCl2, 0.1% IGEPAL CA-630 Extracted nuclei is processed for tagmentation by adding 2.5 µL transposase in 25 µL of TD buffer and incubating the mixture at 37oC for 30 min using the Nextera DNA library prepare kit (Illumina FC-121-1030). Tagmented genomic DNA was purified using DNA clean and concentrator-25 columns (Zymo research D4033). Sequencing libraries were generated using the following forward (5’-aatgatacggcgaccaccgagatctacactcgtcggcagcgtcagatgtg-3’) and barcoded reverse (5’- caagcagaagacggcatacgagat[8-bp barcode]gtctcgtgggctcggagatgt-3’) primers, and by performing 12 cycles of amplification with the Q5 Hot Start High-Fidelity 2X Master Mix (New England Biolabs M0494) using the following cycling conditions: 1 cycle of 72oC for 5 min, 1 cycle of 98oC for 30 sec, 12 cycles of 98oC for 10 sec, 63oC for 30 sec, 72oC for 1 min, hold at 4oC. Libraries were purified using DNA clean and concentrator-25 columns (Zymo research D4033) to remove remaining primers, and amplicon size distributions measured using high sensitivity D5000 screentape (Agilent Technologies 5067-5592). Libraries were then quantified using the Qubit dsDNA High Sensitivity Assay Kit (ThermoFisher Scientific Q32851) and sequenced on the NextSeq550 platform (Illumina) using the NextSeq 500/550 high output kit v2 and following sequencing conditions: 42 cycles of Read 1, 8 cycles of Index 1, 42 cycles of Read 2.
|
|
|
Library strategy |
ATAC-seq |
Library source |
genomic |
Library selection |
other |
Instrument model |
NextSeq 550 |
|
|
Data processing |
Sequences were aligned using bowtie2 version 2.2.9 with -X 2000 Peaks were called with MACS2 version 1.4 with -q .01 –nolambda Peaks were merged with bedtools merge version 2.26 Reads were counted using the featureCounts() function from Rsubread in R Genome_build: mm10
|
|
|
Submission date |
Jul 25, 2019 |
Last update date |
Jul 01, 2020 |
Contact name |
Nicolas Chevrier |
E-mail(s) |
nchevrier@uchicago.edu
|
Organization name |
The University of Chicago
|
Department |
Pritzker School of Molecular Engineering
|
Lab |
Nicolas Chevrier
|
Street address |
5640 South Ellis Avenue
|
City |
Chicago |
State/province |
Illinois |
ZIP/Postal code |
60637 |
Country |
USA |
|
|
Platform ID |
GPL21626 |
Series (1) |
GSE134867 |
ATAC-seq analysis of immune responses from bone marrow derived dendritic cells stimulated with 7 pattern recognition receptor (PRR) ligands along with their pairwise and triplet combinations |
|
Relations |
BioSample |
SAMN12361597 |
SRA |
SRX6589877 |
Supplementary data files not provided |
SRA Run Selector |
Raw data are available in SRA |
Processed data are available on Series record |
|
|
|
|
|