 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Dec 15, 2020 |
| Title |
Wild-type haploid MATa TES seq YPDlog replicate 2 |
| Sample type |
SRA |
| |
|
| Source name |
yeast strains in small batch culture
|
| Organism |
Saccharomyces cerevisiae |
| Characteristics |
strain/background: MATa, ho::LYS2, lys2, ura3, leu2::hisG, his3::hisG, trp1::hisG
treatment: no treatment
|
| Treatment protocol |
none
|
| Growth protocol |
Cells were grown in regular YPD (2.0% (wt/vol) glucose) and grown to saturation (OD600 ~ 10) at 30°C and 300 rpm. About 0.4 OD of saturated yeast culture were inoculated into new flasks containing pre-sporualtion media which contains no glucose. After 16-18 hours, cells were then pelleted, washed with sterile miliQ water, and re-suspended in sporulation (SPO) media at an OD600 of 1.8.
|
| Extracted molecule |
polyA RNA |
| Extraction protocol |
Cell pellets were washed once with sterile water and snap-frozen in liquid nitrogen. Total RNA was extracted using hot acid phenol and TE-SDS buffer, then precipitated in ethanol with 0.3 M sodium acetate before re-suspension in RNAse-free sterile water.
To obtain libraries representing the 3’ ends of polyadenylated transcripts, at least 1 μg was used for 3’ end sequencing. RNA fragments were mixed with 2.5 μM GsuI20TVN primer (/5BiotinTEG/ GAGCTAGTTCTGGAGTTTTTTTTTTTTTTTTTTTTVN), 0.5 mM 5-Methylcytosine-dNTPs (D1030, Zymo Research) and 0.5 μl RNasin Plus. Reaction mixtures were denatured at 65°C for 5 minutes and held at 50°C without allowing to cool. SuperScript IV, reaction buffer and 0.4 μg of Actinomycin D were added to the hot reaction mixtures and reverse transcription was performed at 50°C for 10 minutes, 80°C for 10 minutes and held at 4°C. Samples were cleaned with 1.8x volume HighPrep beads and biotinylated RNA:DNA hybrids were captured on MyOne Streptavidin C1 Dynabeads. After capture, streptavidin beads were washed once with 1x NEbuffer 2 (B7002S, NEB), re-suspended in water and subjected to second strand synthesis. The 50 μl second strand synthesis reaction consisted of 20 μl re-suspended streptavidin beads, 1X NEbuffer 2, 250 μM dNTPs, 26 μM NAD+ (B9007S), 2.5 units RNase H, 10 units E.coli DNA ligase (M0205S), and 15 units DNA polymerase I (M0209S). Second strand synthesis reactions were conducted at 16°C for 2.5 hours on a thermomixer (1400 rpm for 15 seconds, rest for 2 minutes). After reaction, beads were washed once with 1x binding and washing buffer (5.0 mM Tris-HCl pH 7.5, 0.5 mM EDTA, 1.0 M NaCl) and once with buffer B (10 mM Tris-HCl pH 7.5, 10 mM MgCl2, 0.1 mg/ml BSA). Washed beads were re-suspended in 18 μl buffer B and digested with 10 units of GsuI (ER0461, ThermoFisher Scientific) at 30°C for 1 hour on a thermomixer (1400 rpm for 15 seconds, rest for 2 minutes). After digestion, the DNA fragments in the supernatant were extracted with Phenol/chloroform and precipitated at -20°C overnight in ethanol with 0.3 M sodium acetate and 1 μl linear acrylamide. Double-stranded cDNA was quantified by Qubit (Life Technologies) and used as input for library preparation using a KAPA Hyper Prep kit (KAPA Biosystems) and KAPA Single-indexed adapters (KAPA Biosystems). Gel purified libraries were quantified by Qubit and were sequenced on the Illumina HiSeq 4000 platform with 75-base single-end reads.
TES-seq
|
| |
|
| Library strategy |
OTHER |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina HiSeq 4000 |
| |
|
| Description |
TES seq
|
| Data processing |
Adapter trimming was performed with cutadapt (version 1.9.1) (Martin 2011) with parameters “-a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC --minimum-length=20”.
STAR (version 2.5.2) (Dobin et al. 2013) with parameters “--alignIntronMin 2 --alignIntronMax 1” (i.e. not allowing introns) was used to align TES-seq reads to the SK1 genome assembly (plus three spike-in sequences). The alignments with mapping quality of >=10 were kept for further analysis.
For the TES-seq data, the reads kept were those with soft-clipping at the 3’ end (size of soft-clipping part <=10) and with at least two consecutive non-templated As in the soft-clipping part. Insertions/deletions were also not allowed.
Alignments from forward strand and reverse strand were separated by using "samtools view -b -f 0x10" and "samtools view -b -F 0x10". The 3’-most nucleotide of aligned reads were extracted to generate the genome-wide tracks of TSSs.
The tool “bedtools genomecov” (Quinlan and Hall 2010) was used to generate the TES BedGraph tracks across the genome, for both forward and reverse strands. The BedGraph tracks were normalized by the number of usable reads in each library.
BedGraph files were converted to bigWig using the tool bedGraphToBigWig from UCSC (Kent et al., 2010).
Genome_build: SK1 assembly from Keeney lab (http://cbio.mskcc.org/public/SK1_MvO/)
Supplementary_files_format_and_content: Genome-wide bigWig files for both sense and antisense coverage. See data processing step for more details.
|
| |
|
| Submission date |
Oct 15, 2019 |
| Last update date |
Dec 19, 2020 |
| Contact name |
Folkert van Werven |
| E-mail(s) |
Folkert.vanWerven@crick.ac.uk
|
| Organization name |
Francis Crick Institute
|
| Street address |
1 Midland Road
|
| City |
London |
| ZIP/Postal code |
NW1 1AT |
| Country |
United Kingdom |
| |
|
| Platform ID |
GPL21656 |
| Series (2) |
| GSE138897 |
Transcription levels of a long noncoding RNA shape a cell fate regulatory circuit (TES-seq) |
| GSE138898 |
Transcription levels of a noncoding RNA orchestrate opposing regulatory and cell fate outcomes in yeast |
|
| Relations |
| BioSample |
SAMN13032566 |
| SRA |
SRX6996208 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM4121398_3pY2.MOR404A9.forward.TES.norm.bw |
1.2 Mb |
(ftp)(http) |
BW |
| GSM4121398_3pY2.MOR404A9.reverse.TES.norm.bw |
1.2 Mb |
(ftp)(http) |
BW |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
