 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Dec 12, 2019 |
| Title |
171101_mCT_hs_hek293_hek293_mCT_pool_16_AD006_indexed |
| Sample type |
SRA |
| |
|
| Source name |
human embryonic kidney cell
|
| Organism |
Homo sapiens |
| Characteristics |
cell type: human embryonic kidney cell
Sex: Female
donor: HEK293
protocol: scmCT-seq
|
| Growth protocol |
HEK293T cells were cultured in DMEM with 15% FBS and 1% Penicillin-Streptomycin and dissociated with 1X TrypLE. H1 human ESCs (WA01, WiCell Research Institute) were maintained in feeder-free mTesR1 medium (Stemcell Technologies). hESCs (passage 26) were dispersed with 1U/ml Dispase and collected for single-cell sorting or nuclei isolation. Postmortem human brain biospecimens GUID: NDARKD326LNK and NDARKJ183CYT were obtained from NIH NeuroBioBank at University of Miami Brain Endowment Bank. Postmortem human brain biospecimens UMB4540, UMB5577 and UMB5580 are obtained from NIH NeuroBioBank at University of Maryland Brain and Tissue Bank.
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
Nuclei isolation from cultured cells for snmCT-seq: Cell pellets containing 1 million cells were resuspended in 600 µl NIBT [250 mM Sucrose, 10 mM Tris-Cl pH=8, 25 mM KCl, 5mM MgCl2, 0.1% Triton X-100, 1mM DTT, 1:100 Proteinase inhibitor (Sigma-Aldrich P8340), 1:1000 SUPERaseIn RNase Inhibitor (ThermoFisher Scientific AM2694), 1:1000 RNaseOUT RNase Inhibitor (ThermoFisher Scientific 10777019)]. The lysate was transferred to a pre-chilled 2 ml dounce homogenizer (Sigma-Aldrich D8938) and dounced using loose and tight pestles for 20 times each. The lysate was then mixed with 400 µl of 50% Iodixanol (Sigma-Aldrich D1556) and gently pipetted on top of 500 µl 25% Iodixanol cushion. Nuclei were pelleted by centrifugation at 10,000 x g at 4°C for 20 min using a swing rotor. The pellet was resuspended in 2 ml of DPBS supplemented with 1:1000 SUPERaseIn RNase Inhibitor and 1:1000 RNaseOUT RNase Inhibitor. Hoechst 33342 was added to the sample to a final concentration of 1.25 nM and incubated on ice for 5 min for nuclei staining. Nuclei were pelleted by 1,000 x g at 4°C for 10 min and resuspended in 1 ml of DPBS supplemented with RNase inhibitors. Nuclei isolation from human brain tissues and GpC methyltransferase treatment Brain tissue samples were ground in liquid nitrogen with cold mortar and pestle, and then aliquoted and store at -80°C. Approximately 100mg of ground tissue was resuspended in 3 ml NIBT (250 mM Sucrose, 10 mM Tris-Cl pH=8, 25 mM KCl, 5mM MgCl2, 0.2% IGEPAL CA-630, 1mM DTT, 1:100 Proteinase inhibitor (Sigma-Aldrich P8340), 1:1000 SUPERaseIn RNase Inhibitor (ThermoFisher Scientific AM2694), 1:1000 RNaseOUT RNase Inhibitor (ThermoFisher Scientific 10777019)). The lysate was transferred to a pre-chilled 7 ml dounce homogenizer (Sigma-Aldrich D9063) and dounced using loose and tight pestles for 40 times each. The lysate was then mixed with 2 ml of 50% Iodixanol (Sigma-Aldrich D1556) to generate a nuclei suspension with 20% Iodixanol. Gently pipet 1 ml of the nuclei suspension on top of 500 µl 25% Iodixanol cushion in each of the 5 freshly prepared 2ml microcentrifuge tubes. Nuclei were pelleted by centrifugation at 10,000 x g at 4°C for 20 min using a swing rotor. The pellet was resuspended in 1ml of DPBS supplemented with 1:1000 SUPERaseIn RNase Inhibitor and 1:1000 RNaseOUT RNase Inhibitor. A 10 µl aliquot of the suspension was taken for nuclei counting using a Biorad TC20 Automated Cell Counter. One million nuclei aliquots were pelleted by 1,000 x g at 4°C for 10 min and resuspended in 200 µl of GpC methyltransferase M.CviPI (NEB M0227L) reaction containing 1X GC Reaction Buffer, 0.32 nM S-Adenoslylmethionime, 80U 4U/µl M.CviPI, 1:100 SUPERaseIn RNase Inhibitor and 1:100 RNaseOUT RNase Inhibitor and incubated at 37°C for 8 min. The reaction was stopped by adding 800 µl of ice-cold DPBS with 1:1000 RNase inhibitors and mixing. Hoechst 33342 was added to the sample to a final concentration of 1.25 nM and incubated on ice for 5 min for nuclei staining. Nuclei were pelleted by 1,000 x g at 4°C for 10 min, resuspended in 900 µl of DPBS supplemented with 1:1000 RNase inhibitors and 100 µl of 50mg/ml UltrapureTM BSA (Ambion AM2618) and incubated on ice for 5 min for blocking. Neuronal nuclei were labeled by adding 1 µl of AlexaFluor488-conjugated anti-NeuN antibody (clone A60, MilliporeSigma MAB377XMI) for 20 min. For snATAC-seq, nuclei were isolated from frozen mouse brain sections and permeabilized. Nuclei were tagmented with Tn5 in 96 wells to introduce a first barcode (T5 and T7). After pooling, 20 nuclei were sorted into 768 wells and a second barcode (i5 and i7) was introduced by PCR.
Reverse transcription for snmC2T-seq Single cells or single nuclei were sorted into 384-well PCR plates (ThermoFisher 4483285) containing 1 µl mCT-seq reverse transcription reaction per well. The mCT-seq reverse transcription reaction contained 1X Superscript II First-Strand Buffer, 5mM DTT, 0.1% Triton X-100, 2.5 mM MgCl2, 500 µM each of 5’-methyl-dCTP (NEB N0356S), dATP, dTTP and dGTP, 1.2 µM dT30VN_4 oligo-dT primer (5’-AAGCAGUGGUAUCAACGCAGAGUACUTTTTTUTTTTTUTTTTTUTTTTTUTTTTTVN-3’ was used the cultured cell experiments; 5’-/5SpC3/AAGCAGUGGUAUCAACGCAGAGUACUTTTTTUTTTTTUTTTTTUTTTTTUTTTTTVN-3’ was used for human brain experiments), 2.4 µM TSO_3 template switching oligo (/5SpC3/AAGCAGUGGUAUCAACGCAGAGUGAAUrGrG+G), 1U RNaseOUT RNase inhibitor, 0.5 U SUPERaseIn RNase inhibitor, 10U Superscript II Reverse Transcriptase (ThermoFisher 18064-071). For snmC2T-seq, the reaction further included 2 µM N6_2 random primer (/5SpC3/AAGCAGUGGUAUCAACGCAGAGUACNNNNNN). After sorting, the PCR plates were vortexed and centrifuged at 2000 x g. The plates were placed in a thermocycler and incubated using the following program: 25°C for 5 min, 42°C for 90min, 70°C 15min followed by 4°C. cDNA amplification for snmC2T-seq 3 µl of mCT-seq cDNA amplification mix was added into each mCT-seq reverse transcription reaction. mCT-seq cDNA amplification reaction contains 1X KAPA 2G Buffer A, 600 nM ISPCR23_2 PCR primer (/5SpC3/AAGCAGUGGUAUCAACGCAGAGU), 0.08U KAPA2G Robust HotStart DNA Polymerase (5 U/μL, Roche KK5517). PCR reactions were performed using a thermocycler with the following conditions: 95°C 3min -> [95°C 15 sec -> 60°C 30 sec -> 72°C 2min] -> 72°C 5min -> 4°C. The cycling steps were repeated for 12 cycles for scmCT-seq using H1 or HEK293 cells, 15 cycles for snmCT-seq using H1 or HEK293 cells and 14 cycles for snmC2T-seq using human brain tissues. Digestion of unincorporated DNA oligos for snmCT-seq For scmCT-seq and snmCT-seq using H1 and HEK293 cells, 1 µl uracil cleavage mix was added to into cDNA amplification reaction. Each 1 µl uracil cleavage mix contains 0.25 µl Uracil DNA Glycosylase (Enzymatics G5010) and 0.25 µl Endonuclease VIII (Enzymatics Y9080) and 0.5 µl Elution Buffer (Qiagen 19086). Unincorporated DNA oligos were digested at 37°C for 30 min using a thermocycler. We have found that Endonuclease VIII is dispensable for the digestion of unincorporated DNA oligos since the alkaline condition during the desulfonation step of bisulfite conversion can effective cleave abasic sites created by Uracil DNA Glycosylase (Greenberg, 2014). Therefore for snmC2T-seq using human brain tissues, each cDNA amplification reaction was treated with 1µl uracil cleavage mix containing 0.5 µl Uracil DNA Glycosylase (Enzymatics G5010-1140) and 0.5 µl Elution Buffer (Qiagen 19086). For snATAC-seq, nuclei were tagmented with Tn5 in 96 wells to introduce a first barcode (T5 and T7). After pooling, 20 nuclei were sorted into 768 wells and a second barcode (i5 and i7) was introduced by PCR. Libraries were sequenced on a HiSeq2500 (Illumina) with following read lengths: 50 + 14 + 14 + 50 (Read1 + Index1 + Index2 + Read2).
|
| |
|
| Library strategy |
OTHER |
| Library source |
genomic |
| Library selection |
other |
| Instrument model |
Illumina HiSeq 4000 |
| |
|
| Data processing |
Read mapping and the partitioning of transcriptome and methylome reads To map methylome reads, sequencing reads were mapped to in-silico bisulfite converted hg19 reference genome as previously described (Luo et al., 2017). Mapped reads with MAPQ > 10 were retained for further analyses. Sequencing reads with non-CG methylation level < 0.5 and number of cytosine ≥ 3 were considered as true methylome reads. Tab-delimited (allc) files containing methylation level for every cytosine positions was generated using methylpy call_methylated_sites function (Schultz et al., 2015). To map transcriptome reads, sequencing reads were mapped to Gencode V19 transcriptome index using STAR 2.5.2b with the following parameters: --alignEndsType EndToEnd --outSAMstrandField intronMotif --outSAMtype BAM Unsorted --outSAMunmapped Within --outSAMattributes NH HI AS NM MD --sjdbOverhang 100 --outFilterType BySJout --outFilterMultimapNmax 20 --alignSJoverhangMin 8 --alignSJDBoverhangMin 1 --outFilterMismatchNmax 999 --outFilterMismatchNoverLmax 0.04 --alignIntronMin 20 --alignIntronMax 1000000 --alignMatesGapMax 1000000 --outSAMattrRGline ID:4 PL:Illumina. Mapped reads with MAPQ > 10 were retained for further analyses. Non-CG methylation levels for each STAR mapped read was determined from the MD tag. Mapped reads with non-CG methylation levels greater than 0.9 and number of cytosine ≥ 3 were considered as true transcriptome reads. Transcriptome reads were counted across gene annotations using featureCount 1.6.4 (Liao et al. 2014) with the default parameters. Gene expression was quantified using either only exonic reads with -t exon, or both exonic and intronic reads with -t gene. For snATAC-seq data - Using a custom python script, we first de-multicomplexed FASTQ files by integrating the cell barcode (concatenate reads pair in I1.fastq and I2.fastq) into the read name (R1.fastq and R2 fastq) in the following format: "@"+"barcode"+":"+"original_read_name". Demulticomplexed reads were aligned to the corresponding reference genome (hg19) using bwa (0.7.13-r1126) in pair-end mode with default parameter settings. Alignments were then sorted based on the read name using samtools (v1.9). Pair-end reads were converted into fragments and only those that are 1) properly paired (according to SMA flag value); 2) uniquely mapped (MAPQ > 30); 3) with length less than 1000bp were kept. Since fragments were sorted by barcode (integrated into the read name), fragments belonging to the same cell (or barcode) were automatically grouped together which allowed for removing PCR duplicates for each cell separately. Using remaining fragments, a snap-format (Single-Nucleus Accessibility Profiles) file was generated.
Genome_build: hg19
Supplementary_files_format_and_content: tab delimited text files of methylcytosine calls; columns in allc files are: column 1 - chromosome; column 2 - position; column 3 - strand; column 4 - class; column 5 - mC reads; column 6 - total reads; column 7 - methylated (Boolean value indicating the result of statistical test for methylated cytosines). snap file is hierarchically structured hdf5 file that contains the following sessions: header (HD), cell-by-bin matrix (BM), cell-by-peak matrix (PM), cell-by-gene matrix (GM), barcode (BD) and fragment (FM). HD session contains snap-file version, date, alignment and reference genome information. BD session contains all unique barcodes and corresponding meta data. BM session contains cell-by-bin matrices of different resolutions (or bin sizes). PM session contains cell-by-peak count matrix. PM session contains cell-by-gene count matrix. FM session contains all usable fragments for each cell. Fragments are indexed for fast search. A detailed documentation of snap file can be found here (https://docs.google.com/document/d/1AGyn_WJTr0A1SKcfrEgum-jvAJjWd84jZ6DwbwiGRaQ/edit?usp=sharing)
|
| |
|
| Submission date |
Nov 15, 2019 |
| Last update date |
Jun 29, 2020 |
| Contact name |
Joseph R Ecker |
| E-mail(s) |
ecker@salk.edu
|
| Phone |
8584534100
|
| Organization name |
HHMI-Salk-Institute
|
| Department |
Genomic Analysis Laboratory
|
| Lab |
Ecker lab
|
| Street address |
10010 North Torrey Pines Road
|
| City |
La Jolla |
| State/province |
CA |
| ZIP/Postal code |
92037 |
| Country |
USA |
| |
|
| Platform ID |
GPL20301 |
| Series (1) |
| GSE140493 |
Multi-omic profiling of single nuclei uncovers regulatory diversity of brain cell types and diseases |
|
| Relations |
| BioSample |
SAMN13296663 |
| SRA |
SRX7160070 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM4163070_allc_171101_mCT_hs_hek293_hek293_mCT_pool_16_AD006_indexed.tsv.gz |
26.1 Mb |
(ftp)(http) |
TSV |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
| Processed data are available on Series record |
|
|
|
|
 |
