GEO Accession viewer

NCBI > GEO > Accession Display

Not logged in | Login

GEO help: Mouse over screen elements for information.

Sample GSM4427483

Query DataSets for GSM4427483

Status

Public on May 25, 2020

Title

RBM5_total

Sample type

SRA

Source name

MCF7 cell line

Organism

Homo sapiens

Characteristics

library type: cytoLib fragments
treatment: MCF-7 cells were transfected first with siRNAs targeting NXF1 or non-targeting controls for 48h, and then with the CytoLib plasmids for 24h.
cell line: MCF7 cell line
fraction: total RNA

Treatment protocol

For export factor knockdown, cells were transfected with 10nM siRNA pool targeting indicated genes or with a control pool (Dharmacon) using Lipofectamin 3000 reagent (L3000001, Thermo Fisher).

Growth protocol

MCF7 cells (ATCC) were grown in DMEM (Gibco) containing 10% fetal bovine serum and Penicillin-Streptomycin mixture (1%) at 37°C in a humidified incubator with 5% CO2.

Extracted molecule

total RNA

Extraction protocol

One microgram of RNA was used for cDNA production using the qScript Flex cDNA synthesis kit (95049, Quanta) and a gene specific primer containing part of the Illumina RD2 region. The entire cDNA reaction was diluted into 100 μl second strand reaction with a primer containing a unique molecular identifier (UMI) and part of the Illumina RD1 region. The second strand reaction was carried for a single cycle using Phusion Hot Start Flex DNA Polymerase (NEB, M0535), purified using AMpure beads and eluted in 20μl ddH2O. 20µl of the second strand reaction was used for amplification with barcoded primers, and the amplified libraries were purified by two-sided AMpure purification.
Cells were fractionated for WCE, nuclear and cyoplasmic fractions. RNA was extracted with TRIREAGENT (MRC)

Library strategy

RNA-Seq

Library source

transcriptomic

Library selection

cDNA

Instrument model

Illumina NovaSeq 6000

Description

finalTab_siRBM15_and_siWTAP_CytoLib.xlsx

Data processing

SLAM-seq - RNA-seq reads were mapped to the human genome (hg19 assembly) with STAR, and then filtered for 4-Thiouridine-labeled reads using a custom-written Java code, requiring at least 2 T->C mutations in each read pair. Labeled reads were then quantified using RSEM, Bowtie2 and GENCODE v26 annotation, and Cyto/Nuc ratios were normalized as in (Carlevaro-Fita and Johnson 2019). For each sample and fraction, we used genes whose expression levels were between the 50th and 90th percentiles of all annotated genes to estimate the normalization coefficients using a linear regression analysis. These coefficients were used to normalize the Cyto and Nuc data and obtain absolute localization values.
CytoLib - The sequenced reads were used to count individual library tiles using a custom Java script as in (Lubelsky and Ulitsky 2018). We considered only R1 reads that contained the TAGGAGGCCTCATCTGACTG adaptor sequence, and extracted the unique molecular identifier (UMI) sequence preceding the adaptor. Each read was then matched to the sequences in the library, without allowing indels. The matching allowed mismatches only at positions with Illumina sequencing quality of at least 35 and we allowed up to two mismatches in the first 15 nt (‘seed’), and no more than four overall mismatches. If a read matched more than one library sequence, the sequence with the fewest mismatches was selected, and if the read matched more than one library sequence with the same number of mismatches, it was discarded. The output from this step was a table of counts of reads mapping to each library sequence. Only fragments with at least 20 reads on average in the WCE samples were used in subsequent analysis. We then used these to compute nuclear/cytoplasmic and WCE/input ratios after adding a pseudocount of 0.5 to each UPM.
annotation - GENCODE v26
Genome_build: hg19
Supplementary_files_format_and_content: SLAM-seq - nascent_RNA_expression_and_localization.csv contains mean TPM values from RSEM quantification, as well as mean normalized Cyto/Nuc log2 ratios ("localization" columns)
Supplementary_files_format_and_content: CytoLib - finalTab_siRBM15_and_siWTAP_CytoLib.xlsx contains normalized counts for 2 biological replicates, and mean values of WCE/input and of Cyto/Nuc ratios of all library variants

Submission date

Mar 23, 2020

Last update date

May 25, 2020

Contact name

Igor Ulitsky

E-mail(s)

igor.ulitsky@weizmann.ac.il

Organization name

Weizmann Institute of Science

Street address

Hertzl St.