|
| Status |
Public on May 12, 2020 |
| Title |
YY1449 L4440 |
| Sample type |
SRA |
| |
|
| Source name |
population - whole animal
|
| Organism |
Caenorhabditis elegans |
| Characteristics |
tissue: whole animal
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Adult animals were harvested and RNA was extracted using TRIzol Reagent.
Custom library prep.
|
| |
|
| Library strategy |
OTHER |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina MiSeq |
| |
|
| Data processing |
Remove unique molecular identifiers (UMIs) from each read pair and append to the end of the read name using UMI-tools
Trim low-quality bases (quality score < 20) from 3' ends of reads using cutadapt
Trim the 5' adapter (AACAACGAGAAGATCGATGA) from Read 1 using cutadapt
Trim the 3' adapter (GGCGTCGCCATATTCTACTTACACACACACACACACAC) from Read 2 using cutadapt
Trim any 5' adapter sequence (if present) from Read 2 using cutadapt
Discard read pairs that do not contain additional pACs at the 5' end of Read 2
Trim pACs from the 5' end of Read 2 using cutadapt
Discard Read 2 sequences shorter than 5 nucleotides using cutadapt
Align Read 2 sequences to the C. elegans genome using STAR
Generate SAM file of unique alignments using SAMtools
Generate BED file of unique alignments using BEDtools
Deduplicate alignments based on the combination of the UMI and end coordinate
Discard alignments that mapped to the "+" strand and/or to coordinates outside of the oma-1 gene
Split pre-pAC-trimmed version of each remaining read into the aligned portion ("oma-1") and any remaining downstream sequence ("pUG")
If first 1-6 nucleotides of the "pUG" portion have the potential to be templated in oma-1, reassign those nucleotides to the "oma-1" portion
Discard reads with "pUG" portions starting with bases other than "U" or "G" and/or containing 2 or more bases other than "U" or "G"
Genome_build: WS260
Supplementary_files_format_and_content: Excel files listing reads that were called as "oma-1 pUG RNAs" (reads that mapped uniquely to oma-1 and had pUG tails that were longer than the 18nt RT oligo) and the chromosome coordinates of oma-1 pUGylations sites.
|
| |
|
| Submission date |
Apr 06, 2020 |
| Last update date |
May 12, 2020 |
| Contact name |
Aditi Shukla |
| E-mail(s) |
aditishukla@fas.harvard.edu
|
| Phone |
6174321235
|
| Organization name |
Harvard Medical School
|
| Department |
Genetics
|
| Lab |
Kennedy
|
| Street address |
77 Avenue Louis Pasteur, NRB 266
|
| City |
Boston |
| State/province |
MA |
| ZIP/Postal code |
02115 |
| Country |
USA |
| |
|
| Platform ID |
GPL15716 |
| Series (2) |
| GSE148133 |
poly(UG)-tailed RNAs in Genome Protection and Epigenetic Inheritance [other] |
| GSE148134 |
poly(UG)-tailed RNAs in Genome Protection and Epigenetic Inheritance |
|
| Relations |
| BioSample |
SAMN14543711 |
| SRA |
SRX8062600 |
