|
| Status |
Public on May 13, 2020 |
| Title |
first run_D10_B2 |
| Sample type |
SRA |
| |
|
| Source name |
RevCEM E7 cells infected with NL4-3
|
| Organism |
Human immunodeficiency virus 1 |
| Characteristics |
cell line: RevCEM E7 cells
treatment: Cells treated every 2 days with Efavirenz
time: First run_Day 10
population/single cell: single cells
|
| Treatment protocol |
Experiments were initiated with a cell-free infection, where 10^6 cells/ml RevCEM E7 were infected with 2 x 10^8 NL4-3 viral copies/ml (approximately 20ng p24 equivalent) for 2 days. Infected cells from the cell-free infection were used as the donors and cocultured with 10^6 cells/ml target cells. After two days of infection, 2% of the infected cells were added to uninfected target cells and cocultured for a 2-day cycle (day 0). Thereafter, 2% of resuspended infected cells were added to uninfected targets in the presence of EFV and co-cultured for each 2-day cycle.
|
| Growth protocol |
Cell culture and experiments were performed in complete RPMI 1640 medium supplemented with L-Glutamine, sodium pyruvate, HEPES, non-essential amino acids (Lonza), and 10\% heat-inactivated FBS (Hyclone).
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
For infected single cells, the cells were lysed and DNA was kept suspended in the lysis buffer. For infected cell populations, genomic DNA was extracted using the QIAamp DNA mini kit (Qiagen)
Phusion hot start II DNA polymerase (New England Biolabs) PCR reaction mix (10$ul 5 x Phusion HF buffer, 1ul dNTPs, 2.5ul of the forward primer, 2.5ul of the reverse primer, 0.5ul Phusion hot start II DNA polymerase, 2.5ul of DMSO and molecular biology grade water to 50ul reaction volume) was added to the lysed single cells or extracted genomic DNA of cell populations. Two rounds of PCR were performed. The first-round reaction amplified a region of the RT gene in the proviral DNA using the forward primer 5’ tcgtcggcagcgtcagatgtgtataagagacagTTAATAAGAGAACTCAAGATTTC 3’ and reverse primer 5’ gtctcgtgggctcggagatgtgtataagagacagCCCCACCTCAACAGATGTTGTC 3’. Non-capitalized portion of the primers represent the Nextera XT Index Kit adaptors. Cycling program was 98C for 30 seconds, then 35 cycles of 98C for 10 seconds, 50C for 30 seconds and 72C for 15 seconds with a final extension of 72C for 5 minutes. 1$\mu l$ of the first round product was then transferred into a PCR mix as above, with second round Nextera XT Index Kit adaptor primers (forward 5’ tcgtcggcagcgtcagatgtgtataagagacag 3’, reverse 5’ gtctcgtgggctcggagatgtgtataagagacag 3’). The second round PCR amplified a 400bp product which was then visualized on a 1% agarose gel. The PCR amplicon was gel extracted using the QIAquick gel extraction kit (Qiagen). Illumina indices were attached to the amplicon with the Nextera XT Index Kit and deep sequenced using the Illumina Miseq. Fast-q files were analysed in Geneious.
amplicon sequencing using illumina MiSeq with adaptors from Nextera kit
|
| |
|
| Library strategy |
OTHER |
| Library source |
genomic |
| Library selection |
other |
| Instrument model |
Illumina MiSeq |
| |
|
| Description |
Reverse transcriptase region of HIV provirus
~ 300bp amplicon of the Reverse trancriptase region of HIV containing all the Efavirenz resistant mutants
|
| Data processing |
Illumina Casava1.7 software used for basecalling.
Sequenced reads were trimmed for adaptor sequence, and masked for low-complexity or low-quality sequence (minimum mapping quality Q30), then mapped to HIV NL4-3 using Geneious v 11.1.4
For SNP detection in cell population experiments: minimum variant frequency of 0.01 and maximum variant p-value 0.0001
For SNP detection in single experiments: minimum variant frequency of 0.05 and maximum variant p-value 0.0001
Genome_build: AF324493.2
Supplementary_files_format_and_content: comma separated files (csv) containing the variant raw frequency of mutants, the quality score, coverage as wells as the unique identifiers for each read that has a SNP in it
|
| |
|
| Submission date |
May 12, 2020 |
| Last update date |
May 14, 2020 |
| Contact name |
Alex Sigal |
| E-mail(s) |
alexander.sigal@gmail.com
|
| Organization name |
Africa Health Research Institute (AHRI)
|
| Street address |
719 Umbilo Road, Congella
|
| City |
Durban |
| State/province |
-- SELECT -- |
| ZIP/Postal code |
4001 |
| Country |
South Africa |
| |
|
| Platform ID |
GPL23868 |
| Series (1) |
| GSE150390 |
Complementation can maintain a quasispecies of drug sensitive and resistant HIV |
|
| Relations |
| BioSample |
SAMN14898837 |
| SRA |
SRX8330720 |
