 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Jan 31, 2023 |
| Title |
Mouse, embryos, cell-GasbE751074 |
| Sample type |
SRA |
| |
|
| Source name |
Embryos
|
| Organism |
Mus musculus |
| Characteristics |
tissue: Embryos
strain: C57BI6/J(female)x CAST/EiJ(male)
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
All animal maintenance and experimental procedures were carried out in accordance with the guidelines of the Institutional Animal Care and Use Committee (IACUC) of Peking University. Cast/Eij male and C57BL/6J female mice were purchased from Jackson Laboratory and raised under 12h brightness and 12h darkness. 8-week-old mice were naturally mated and females were transferred on the next morning (considered as E0.5). Post-implantation embryos were collected in PBS containing 10%FBS between E7.0 and E11.5. For brain tissues, left cortex was dissected from 8 to 9-week-old F1 hybrid mice in ice-cold PBS.
Mouse Embryos. For E7.0 - E8.5 embryos, all embryos from one mouse were collected and dissociated in 100 μL TrypLE™ Express (Gibco 12604013) for 5 min. For E9.5 - E11.5 embryos, one or two embryos from one mouse were collected and dissociated in 200 μL TrypLE™ Express for 10 min. TrypLE™ Express was inactivated by adding 5-fold volume of PBS. The cell suspension was then filtered with a 40 μm cell strainer (Falcon 352340) and centrifuged at 100 g fro 5 min at 4 C. The pellet was washed once with 500 μL PBS and the cell number was adjusted to ~100 k in 200 μL PBS.
Mouse Brains. Cortex was dissected in ice-cold PBS and transferred to a 1 mL Dounce homogenizer (Wheaton 357538) containing 1mL ice-cold Homogenization Buffer (250 mM sucrose, 25 mM KCl, 5 mM MgCl2, 10 mM HEPES pH 8.0, 1 μM DTT, 0.1% Igepal CA 630) with 10 μL Recombinant RNase Inhibitor (TaKaRa 2313B), 10 μL SUPERaseIn (Invitrogen AM2694) and 100 μL protease inhibitor (Sigma P8340). Dissected tissues were homogenized with five strokes of the loose pestle, followed by 15 strokes of the tight pestle. The homogenate was filtered through a 40 μm cell strainer and centrifuged at 300 g for 5 min at 4 C. The pellet was washed in 500 μL Nuclei Storage Buffer (166.5 mM sucrose, 25 mM KCl, 5 mM MgCl2, 10 mM HEPES pH 8.0) with 5 μL Recombinant RNase Inhibitor and 50 μL protease inhibitor and centrifuged at 300 g for 5 min at 4 °C. The pellet was resuspended with 500 μL of Nuclei Storage Buffer to estimate the number of intact nuclei. Then the number of nuclei was adjusted to ~250 k in 500 μL Nuclei Storage Buffer.
The single-cell preamplification product was diluted for 15 folds and 2 μL of each diluted sample was transposed by the addition of 3 μL Transposition Mixture (1 μL 5 X TTBL, 0.25 μL TTE Mix V50 (Vayme TD501), 1.75 μL water) and incubated at 55 °C for 10 min. Transposition was stopped by adding 1.25 μL 0.2% SDS and then the plate 40 was incubated at room temperature for 10 min. For a slight enrichment of cDNA reads, 2 μL 5 μM i5 unique dual (UD) index and 11.75 ul PCR mixture (4 μL 5X KAPA HiFi GC Buffer, 0.6 μL 10 mM dNTP, 0.2 μL 50 μM RNA-P7 primer, 0.4 μL KAPA HiFi DNA Polymerase (KAPA KK2102) and 6.55 μL water) were added to each well and incubated with the following program: Step 1: 72 °C × 3 min; Step 2: 98 °C × 30 s; Step 3: 98 °C × 15 s, 60 °C × 30 s, 72 °C × 2 min 45 and repeat Step 3 for an additional 5 times; Step 4: 4 °C hold on. Then 2 μL 5 μM i7 UD index was added and incubated with: Step 1: 4 °C × 3 min; Step 2: 98 °C × 30 s; Step 3: 98 °C × 15 s, 60 °C × 30 s, 72 °C × 2 min and repeat Step 3 for an additional 5 times; Step 4: 72 °C × 5 min. The sequence of RNA-P7 primer was GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGTTGAGGTAGTATTGCGCAATG. The barcoded single-cell libraries were then pooled and purified with 0.6 × and 0.15 × AMPure XP Beads (Beckman, A63881). The final libraries were sequenced with paired end 150-bp reads on a NovaSeq 6000 (Illumina) platform according to the manufacturer’s instructions.
|
| |
|
| Library strategy |
OTHER |
| Library source |
genomic |
| Library selection |
other |
| Instrument model |
Illumina NovaSeq 6000 |
| |
|
| Data processing |
For in silico isolation of RNA from DNA reads, we used Cutadapt (version 3.5) to identify and extract RNA reads which contained a specific sequence (GGTTGAGGTAGTATTGCGCAATG) within the GAT5-RT primer from the 5-prime end of 5 Read 2. The RNA reads and DNA reads were then processed separately as two files.
We preprocessed Hi-C part of HiRES data as previously described with custom scripts. Briefly, reads were mapped to the GRCm38 reference genome with BWA-mem2 in “5SP” mode. Contacts and 3D genome structures were generated with Hickit software using default parameters. To remove potential contamination from RNA reads, we cleaned contacts between 10 two exons from the same transcript, which counted for ~0.04% of all contacts. For quality control of reconstructed 3D genome structures, five replicates were generated with random seeds, and median RMSD for each combination of 3 replicates was calculated. The first replicate in the combination with the minimum median RMSD value (if < 1.5) were used for downstream analysis. 3D proximity and 3D distance maps were generated as previously descried with custom codes.
For RNA data, we first removed reads containing no poly-A sequence following GAT5-RT primer sequence. We then aligned Read 1 to the GRCm38 reference genome using STAR. Duplications were removed based on UMIs with UMI-tools. RNA count matrix was generated by FeatureCounts with parameters “-O -M --fraction”. We used RNAsnpSplit for phasing of allele-specific RNA counts.
Assembly: GRCm38
Supplementary files format and content: Tab-separated values files and matrix files
|
| |
|
| Submission date |
Jan 28, 2023 |
| Last update date |
Feb 01, 2023 |
| Contact name |
Zhiyuan Liu |
| E-mail(s) |
lemonhhh1030@gmail.com
|
| Phone |
18818223086
|
| Organization name |
Peking University
|
| Street address |
Yiheyuan Road
|
| City |
Beijing |
| ZIP/Postal code |
100871 |
| Country |
China |
| |
|
| Platform ID |
GPL24247 |
| Series (1) |
| GSE223917 |
Linking genome structures to functions during lineage specification by simultaneous single-cell Hi-C and RNA-seq simultaneous single-cell Hi-C and RNA-seq |
|
| Relations |
| BioSample |
SAMN32023250 |
| SRA |
SRX18487112 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM6999080_GasbE751074.20k.0.clean.3dg.txt.gz |
7.1 Mb |
(ftp)(http) |
TXT |
| GSM6999080_GasbE751074.pairs.gz |
3.5 Mb |
(ftp)(http) |
PAIRS |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
| Processed data are available on Series record |
|
|
|
|
 |
