 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Jun 16, 2024 |
| Title |
CD4 g7g7 5 |
| Sample type |
SRA |
| |
|
| Source name |
Peripheral lymph nodes
|
| Organism |
Mus musculus |
| Characteristics |
tissue: Peripheral lymph nodes
cell type: naive CD4 T cell
genotype: g7g7
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Mice were euthanized, and axillary, brachial, inguinal, mesenteric, lumbar, and caudal lymph nodes were collected and filtered through a sterile 100µM filter. Cells were resuspended and washed 3x in BSS in a 15 ml conical tube. Cells were counted and resuspended in BSS supplemented with 1% BSA and anti-mouse CD16/CD32 (Clone: 2.4G2), as a pre-treatment reagent to block non-antigen-specific interactions of immunoglobulins to the FcγIII and FcγII, and possibly FcγI. Lymphocytes were stained with antibodies specific to TCRβ, CD45R, CD4, CD8, CD44, CD62L, and CD25 for 30 mins, washed 3x in BSS wash buffer. Cells were resuspended at 107/ml and fluorescently sorted for naïve lymphocytes on an iCyt Synergy.
RNA was isolated from purified naïve CD4 T cells using the RNeasy Kit (Invitrogen). cDNA was made using the SuperScript VILO Kit (Invitrogen). For sequencing of TCR α-chains, a two-step PCR was done which added the machine oligonucleotides as well as barcodes for the sequencing runs. The first PCR included a reverse oligonucleotide in the constant region of the α-chain and a mixture of forward oligonucleotides that together cover all the different TCRα family members. The sequence or sequences for each TRAV family are as follows: TRAV01: GAGGGAACCTTTGCTCGGGTC; TRAV02: TATGAAGGGCAAGAAGTGAAC; TRAV03: CArGTCTTCAGTTGCTTATGA; TRAV04: TGCTCTGAGATGCAATTTTwC; TRAV05a: GGTGGAACAGCTCCCTTCCTC; TRAV05b: ATGGCTGCAGCTGGATGGGA; TRAV06a: GGACAAGGTCCACAGCTCCT; TRAV06b: GGAGAAGGTCCACAGCTCCTC; TRAV06c: GTCCAATATCCTGGAGAAGG; TRAV07: AGCAGAGCCCAGAATCCCTCA; TRAV08: AAAGAGCCAATGGGGAGAAG; TRAV08, GAATAGTCAACTAGCAGAAG; TRAV09: AGCTGAGATGCAAsTATTCCT; TRAV10: ACTTACACAGATACTGCyTCA; TRAV11: CACAGGCAAAGGTCTTGTGTC; TRAV12: GCTGAACTGCACCTATCAGA; TRAV13: TGGTTCTGCAGGAGGGGGArA; TRAV14: GTCCCCAATCTCTGACAGTCT; TRAV15: ACTGTTCATATrAGACAAGT; TRAV16: TGGAGAAGACAACGGTGACA; TRAV17: GTTATTCATACAGTGCAGCAC; TRAV18: ACCGCACGCTGCAGCTCCTCA; TRAV19: TACCCTGACAACAGCCCCACA; TRAV21: GTAGCCACGCCACAATCAGTG. The second PCR included just one forward oligonucleotide to add the machine oligonucleotide and a reverse oligonucleotide to add the barcode. For TCR β-chains, one PCR was done that contained a forward oligonucleotide priming all three TRBV13 family members at an identical region, the sequencing machine oligonucleotide CCACTACGCCTCCGCTTTCCTCTCTATGGGCAGTCGGTGATGCTGAGGCTGATCCATTA, and a reverse oligonucleotide that primed the Cβ region and contained the machine oligonucleotide and the barcode, CCATCTCATCCCTGCGTGTCTCCGACTCAGCTAAGGTAACGATCTTGGGTGGAGTCACATTTCTC.
|
| |
|
| Library strategy |
OTHER |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Ion GeneStudio S5 prime |
| |
|
| Data processing |
MKION VDJ sequence analysis v 1.0
Sequence reads were trimmed for short and long reads (>100nt, <800nt)
Out-of-frame sequences were recovered by repairing the TRAJ segment by mapping back to germline
Organize by clonotype and reformat columns into immunarch format
Assembly: mm9
Supplementary files format and content: Comma-separated text file including ranked TCR clonotype counts for each Sample
Library strategy: TCR-Seq
|
| |
|
| Submission date |
Jun 12, 2024 |
| Last update date |
Jun 16, 2024 |
| Contact name |
Philippa Marrack |
| E-mail(s) |
marrackp@njhealth.org
|
| Phone |
3033981324
|
| Organization name |
National Jewish Health
|
| Department |
Immunology & Genomic Medicine
|
| Lab |
Kapper Marrack Lab
|
| Street address |
1400 Jackson St
|
| City |
Denver |
| State/province |
CO |
| ZIP/Postal code |
80206 |
| Country |
USA |
| |
|
| Platform ID |
GPL34581 |
| Series (1) |
| GSE269649 |
MHC II Heterozygosity Limits T Cell Receptor Variability in CD4 T Cells |
|
| Relations |
| BioSample |
SAMN41129765 |
| SRA |
SRX24404187 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM8324057_687_c520_postJ.csv.gz |
614.8 Kb |
(ftp)(http) |
CSV |
SRA Run Selector |
| Raw data are available in SRA |
|
|
|
|
 |
